Differential Expression of Matrix Metalloproteinases and Inhibitors in Developing Rat Lung Mesenchymal and Epithelial Cells

0031-3998/07/6201-0020 PEDIATRIC RESEARCH Copyright © 2007 International Pediatric Research Foundation, Inc. Vol. 62, No. 1, 2007 Printed in U.S.A. Differential Expression of Matrix Metalloproteinases and Inhibitors in Developing Rat Lung Mesenchymal and Epithelial Cells OLIVIER BOUCHERAT, JACQUES R. BOURBON, ANNE-MARIE BARLIER-MUR, BERNADETTE CHAILLEY-HEU, MARIE-PIA D’ORTHO, AND CHRISTOPHE DELACOURT INSERM Unité 841, IMRB, Département Biologie et Thérapeutique Cardiorespiratoires et Hépatiques, Créteil, F-94000 France; Université Paris 12, Faculté de Médecine, Créteil, F-94000 France (6). The question of relative contributions is all the more important in that reciprocal epithelial-mesenchymal interactions are crucial for all lung developmental steps (9). Moreover, more attention has been paid thus far to early fetal lung development than to later stages. Further documenting late development may help to better understand the significance of changes in MMP activity associated with neonatal chronic lung disease (10,11). In the present study, we investigated expression changes in MMPs/TIMPs in fibroblasts and AECs extemporaneously isolated from the rat lung, from the end of pseudoglandular stage to alveolar stage. We also studied comparatively cells expressing in vitro either the ATI or ATII phenotype. Because a global study of MMPs and TIMPs could not be considered, we focused on proteins with known particular importance, including MMP-2 and MT1-MMP (or MMP-14) that are involved in alveolar formation (12–14), TIMP-1 (the major MMP inhibitor), and TIMP-2, which controls MMP-2 activation (15). These are among the most expressed matrixremodeling molecules in the lung, as evidenced in a profiling study in various organs of the developing mouse (5). Because we focused on late development, TIMP-3 that is important earlier during branching morphogenesis (16) was not included. ABSTRACT: Lung development requires extracellular matrix remodeling. This involves matrix metalloproteinases (MMPs) and their endogenous inhibitors [tissue inhibitors of metalloproteinases (TIMPs)]. Because these have been generally studied only in whole lung, we focused specifically on mesenchymal and epithelial cells freshly isolated at various developmental stages. In fibroblasts, the most striking developmental change was a peak (fourfold the prenatal level) of membrane type 1 (MT1)-MMP transcript during alveolarization, consistent with the known crucial role of MT1-MMP in this process. TIMP-1 and -2 mRNAs transiently increased on postnatal d (pn) 3. In alveolar epithelial cells (AECs), MMP-2 expression was maximal on fetal d (f) 19 when alveolar type II cells (ATII) differentiate and on pn5; by contrast, MT1-MMP expression changed little and TIMP-1 expression decreased with advancing gestation. In cells expressing in vitro the ATI phenotype, TIMP-1 and -2 activities were nine- and fivefold those in cells expressing ATII features, respectively, whereas ATII presented higher MMP-2 activity and were the only cell type to express MMP-9. This indicates higher remodeling potential for ATII. Pulmonary mesenchymal and epithelial cells have therefore quite distinct MMP/TIMP expression patterns. Changes in cell compartments should be specifically documented in developing lung diseases such as bronchopulmonary dysplasia in which changes in MMP activities have been reported. (Pediatr Res 62: 20–25, 2007) E xtracellular matrix (ECM) is essential to lung morphogenesis and to cell differentiation, growth, and motility (1). The successive pseudoglandular, canalicular, saccular, and alveolar stages of lung development (2) all involve remodeling of ECM (1). Zinc-dependent endopeptidases, the MMPs, carry out ECM proteolysis (3). Their activity is regulated by various mechanisms in which TIMPs play a prominent role (3). A variety of MMPs and TIMPs are expressed in the developing lung (4,5). Although epithelial and mesenchymal cells appear to have distinct MMP/TIMP expression features (4,6), expression changes in MMPs and TIMPs across the different developmental steps have generally been studied only in the whole lung (4,5,7,8). When epithelial and mesenchymal cells were studied comparatively, it was for a very limited period MATERIALS AND METHODS Lung cell isolation. Dated pregnant Sprague-Dawley rats (Charles River, Saint Germain sur l’Arbresle, France) were used. Animal procedure was authorized by the French Ministry of Agriculture. AECs and fibroblasts were isolated by differential adhesion and centrifugation as described (17), on f17 (pseudoglandular stage), f19 (canalicular stage), f21, and pn1 and 3 (saccular stage), pn5 and 8 (alveolar stage, progressing septation), and pn16 (alveolar stage, terminated septation). Epithelial cells isolated by this procedure express characteristic ATII markers (17). Freshly isolated cells were immediately frozen without any culture step and stored at ⫺80°C. AEC culture. To determine whether cells expressing the ATI or ATII features have different MMP/TIMP equipment, AECs isolated on pn21 were seeded on substrata reported to favor either phenotype. Engelbreth-Holm- Abbreviations: AECs, alveolar epithelial cells; ATI (II), alveolar type I (type II) cells; CF, collagen-fibronectin coating; CFL, collagen-fibronectinlaminin 5 coating; CM, conditioned medium; EHS matrix, EngelbrethHolm-Swarm basement-membrane matrix; f, fetal day; MMP, matrix metalloproteinase; pn, postnatal day; SP-B, surfactant protein B; TIMP, tissue inhibitor of metalloproteinases Received November 16, 2006; accepted February 16, 2007. Correspondence: Jacques Bourbon, Ph.D., Inserm U841, Faculté de Médecine, 8 rue du Général Sarrail, 94010 Créteil, France; e-mail: This work was supported by regular INSERM funding without extramural source. 20 21 MMPs/TIMPs IN DEVELOPING RAT LUNG CELLS Table 1. Sequences of primers used to amplify TIMP-1, TIMP-2, MMP-2, and MT1-MMP cDNA fragments TIMP-1 TIMP-2 MMP-2 MT1-MMP Forward (5=-3=) Reverse (5=-3=) cDNA length (bp) TM CCAGAAATCATCGAGACCACCT ATTTATCTACACGGCCCC TGATCTCCAGTGCCCTC GTACTACCGCTTCAATGAGG GGCAGGCAAAGTGATCGCTC CAAGAACCATCACTTCTCTTG TGGCGAACACAGCACTC CACTGCCAGTACCAGGAG 420 341 410 363 55°C 58°C 60°C 58°C Swarm basement membrane matrix [(EHS matrix) prepared in the laboratory] and a coating designated collagen-fibronectin-laminin 5 coating (CFL) composed of collagen I (8 ␮g/cm2; BD Biosciences, Erembodegem, Belgium), fibronectin (2.1 ␮g/cm2; Sigma Chemical Co., L’Isle d’Abeau-Chesnes, France), and laminin 5 (0.5 ␮g/cm2; gift from P. Rousselle, Institute of Protein Biology and Chemistry, CNRS, Lyon, France), both support the ATII phenotype. Plastic and a collagen-fibronectin coating (CF), composed only of collagen I and fibronectin (same concentrations), favor transdifferentiation into ATI (18,19). Purified AECs in 10% fetal bovine serum (FBS)– containing medium were seeded (1.5 ⫻ 106 cells/mL) in multiwell plastic culture plates eith (...truncated)