Expression of steroidogenic enzymes and metabolism of steroids in COS-7 cells known as non-steroidogenic cells

Scientific Reports, Feb 2018

The COS-7 (CV-1 in Origin with SV40 genes) cells are known as non-steroidogenic cells because they are derived from kidney cells and the kidney is defined as a non-steroidogenic organ. Therefore, COS-7 cells are used for transfection experiments to analyze the actions of functional molecules including steroids. However, a preliminary study suggested that COS-7 cells metabolize [3H]testosterone to [3H]androstenedione. These results suggest that COS-7 cells are able to metabolize steroids. Therefore, the present study investigated the expression of steroidogenic enzymes and the metabolism of steroids in COS-7 cells. RT-PCR analyses demonstrated the expressions of several kinds of steroidogenic enzymes, such as cytochrome P450 side-chain cleavage enzyme, 3β-hydroxysteroid dehydrogenase/Δ5-Δ4 isomerase, cytochrome P450 7α-hydroxylase, cytochrome P450 17α-hydroxylase/17,20-lyase, 17β-hydroxysteroid dehydrogenase, 5α-reductase, cytochrome P450 21-hydroxylase, cytochrome P450 11β-hydroxylase, and cytochrome P450 aromatase in COS-7 cells. In addition, steroidogenic enzymes 3β-HSD, P4507α, 5α-reductase, P450c17, P450c21, P450c11β, and 17β-HSD actively metabolized various steroids in cultured COS-7 cells. Finally, we demonstrated that 17β-HSD activity toward androstenedione formation was greater than other steroidogenic enzyme activities. Our results provide new evidence that COS-7 cells express a series of steroidogenic enzyme mRNAs and actively metabolize a variety of steroids.

Article PDF cannot be displayed. You can download it here:

https://www.nature.com/articles/s41598-018-20226-2.pdf

Expression of steroidogenic enzymes and metabolism of steroids in COS-7 cells known as non-steroidogenic cells

www.nature.com/scientificreports OPEN Received: 6 October 2017 Accepted: 15 January 2018 Published: xx xx xxxx Expression of steroidogenic enzymes and metabolism of steroids in COS-7 cells known as non-steroidogenic cells Mitsuki Nozaki1, Shogo Haraguchi1,2, Takuro Miyazaki2, Daichi Shigeta1, Noriko Kano1, XiaoFeng Lei2, Joo-ri Kim-Kaneyama2, Hiroyuki Minakata3, Akira Miyazaki2 & Kazuyoshi Tsutsui1 The COS-7 (CV-1 in Origin with SV40 genes) cells are known as non-steroidogenic cells because they are derived from kidney cells and the kidney is defined as a non-steroidogenic organ. Therefore, COS-7 cells are used for transfection experiments to analyze the actions of functional molecules including steroids. However, a preliminary study suggested that COS-7 cells metabolize [3H]testosterone to [3H] androstenedione. These results suggest that COS-7 cells are able to metabolize steroids. Therefore, the present study investigated the expression of steroidogenic enzymes and the metabolism of steroids in COS-7 cells. RT-PCR analyses demonstrated the expressions of several kinds of steroidogenic enzymes, such as cytochrome P450 side-chain cleavage enzyme, 3β-hydroxysteroid dehydrogenase/ Δ5-Δ4 isomerase, cytochrome P450 7α-hydroxylase, cytochrome P450 17α-hydroxylase/17,20-lyase, 17β-hydroxysteroid dehydrogenase, 5α-reductase, cytochrome P450 21-hydroxylase, cytochrome P450 11β-hydroxylase, and cytochrome P450 aromatase in COS-7 cells. In addition, steroidogenic enzymes 3β-HSD, P4507α, 5α-reductase, P450c17, P450c21, P450c11β, and 17β-HSD actively metabolized various steroids in cultured COS-7 cells. Finally, we demonstrated that 17β-HSD activity toward androstenedione formation was greater than other steroidogenic enzyme activities. Our results provide new evidence that COS-7 cells express a series of steroidogenic enzyme mRNAs and actively metabolize a variety of steroids. The COS-7 (CV-1 in Origin with SV40 genes) cell line was developed by Prof. Yakov Gluzman in the early 1980s. It is derived from the CV-1 African green monkey kidney fibroblast cell line transformed by a mutant strain of Simian Virus 40 (SV40) that codes for the wild-type T-antigen1,2. This cell line has unique characteristics of fibroblast-like growth and virus susceptibility1,2. These characteristics make COS-7 cells a popular research tool and an excellent choice for DNA plasmid transfection experiments1–5. Many previous studies have reported that COS-7 cells are non-steroidogenic cells6–8. The COS-7 cell line is derived from kidney cells and the kidney is defined as a non-steroidogenic organ9,10. Therefore, COS-7 cells have been used for transfection experiments to analyze the functions of steroidogenic genes11–13, steroid receptors14–16, and the effects of steroids on functional molecules17,18. A preliminary study in our laboratory suggested that COS-7 cells actively metabolize [3H]testosterone to [3H] androstenedione (S. Haraguchi et al., unpublished observations). In addition, the expression of steroidogenic enzymes in the kidney of humans19–21 and rodents22–24 has been reported. These results suggest that COS-7 cells may metabolize steroids. Based on this background, in the present study, a series of experiments was conducted to demonstrate the expression of steroidogenic enzymes and metabolism of steroids in COS-7 cells, which are known as non-steroidogenic cells. Because pregnenolone formation is the first step in steroid synthesis25–27, we first investigated the formation of [3H]pregnenolone from [3H]cholesterol in cultured COS-7 cells. Steroidogenic acute 1 Laboratory of Integrative Brain Sciences, Department of Biology and Center for Advanced Biomedical Sciences of Waseda University, Tokyo, 162-8480, Japan. 2Department of Biochemistry, Showa University School of Medicine, Tokyo, 142-8555, Japan. 3Suntory Foundation for Life Sciences, Kyoto, 619-0284, Japan. Correspondence and requests for materials should be addressed to S.H. (email: ) or K.T. (email: k-tsutsui@ waseda.jp) SCIentIfIC REpOrTS | (2018) 8:2167 | DOI:10.1038/s41598-018-20226-2 1 www.nature.com/scientificreports/ Primer Forward primer 5′->3′ Reverse primer 5′->3′ StAR GAGCTCTCTGCTCGGTTCTC CGCCCTGATGACACCTTTCT P450scc CCCGATTTACAGGAAGTCAGC TCTGTAGAGGATGCCACGGT 3β-HSD type I GAGGGAGGAATTTTCCAAGCTCCA GTCTTTCAGAGTCCACCCATCA 3β-HSD type VII CCTTCTACAGGGGCAACGAA GAACACCAGCAGCCAGTAGG P4507α GCCTGATCTGCCTAGAAAGCA TGAATACCAAACAACAAGCGGT P450c17 CGGCCTCAAGTGACAACTCT GGTGATAGAGTCACTGCGGAA 17β-HSD type I TCAGACCCATCCCAGAGCTT CTCGATCAGGCTCAAGTGGAC 17β-HSD type II CAAATGGACGTCACGAAGCC CGTGCCTGCGATACTTGTTC 17β-HSD type III CCAAAGCCTTTCTTGCGGTC CACACAAACGCCTTGGAAGC 17β-HSD type IV TGGCCAGCTATGATTCAGTGG CAAAGCCAAAGGACAAGCGG 5α-Reductase type I CGGGCATCGGTGCTTAATTT GAGTGCATGACAGCAGGAGA 5α-Reductase type II GTGCATTACTTCCACAGGACA CAGCCCAAGGAAACAAACCG 5α-Reductase type III TCAGTGCTGTGGAATGGCTT CAGTGAATGACCACTCCTGCT P450arom TCCCTTTGGACGAAAGTGCT CTGGTACCGCATGCTCTCAT P450c11β GATAGCCTGCATCCCCACAG AGTTGTCGCCGTACTGGAAG P450c21 CGACCTCCCCATCTATCTGC GGGAAGAACTTGATCTTGTCTCCA Table 1. Primers for PCR analyses. regulatory protein (StAR; gene name Star) delivers cholesterol to the mitochondrial cytochrome P450 side-chain cleavage enzyme (P450scc; gene name Cyp11a), which produces pregnenolone. RT-PCR analyses demonstrated P450scc mRNA expression in COS-7 cells. We further demonstrated that the mRNAs of several kinds of steroidogenic enzymes 3β-hydroxysteroid dehydrogenase/Δ5-Δ4 isomerase (3β-HSD; gene name Hsd3b), cytochrome P450 7α-hydroxylase (P4507α; gene name Cyp7b), cytochrome P450 17α-hydroxylase/17,20-lyase (P450c17; gene name Cyp17), 17β-hydroxysteroid dehydrogenase (17β-HSD; gene name Hsd17b), 5α-reductase (gene name Srd5a), cytochrome P450 21-hydroxylase (P450c21; gene name Cyp21), cytochrome P450 11β-hydroxylase (P450c11β; gene name Cyp11b1), and cytochrome P450 aromatase (P450arom; gene name Cyp19) are expressed in COS-7 cells. In addition, steroidogenic enzymes 3β-HSD, P4507α, 5α-reductase, P450c17, P450c21, P450c11β, and 17β-HSD were active in cultured COS-7 cells. Especially, androstenedione formation from testosterone catalyzed by 17β-HSD was greater than other steroidogenic enzyme activities. Our results provide new evidence that COS-7 cells express a series of steroidogenic enzyme mRNAs and actively metabolize a variety of steroids. Materials and Methods COS-7 cells. The COS-7 cell line (JCRB9127) was purchased from the Japanese Collection of Research Bioresources (JCRB) cell bank (Osaka, Japan). COS-7 cells were maintained in DMEM (043-30085; Wako, Osaka, Japan) supplemented with 10% FBS (S1820-500; BioWest, Nuaill, France) and a 1% penicillin-streptomycin solution (Wako, Osaka, Japan) at 37 °C in a humidified 5% CO2-containing atmosphere. COS-7 cells were used in the experiments between passages 3 and 15, or passages 30 and 40. RT-PCR analyses of steroidogenic enzyme mRNAs. Total R (...truncated)


This is a preview of a remote PDF: https://www.nature.com/articles/s41598-018-20226-2.pdf
Article home page: https://www.nature.com/articles/s41598-018-20226-2

Mitsuki Nozaki, Shogo Haraguchi, Takuro Miyazaki, Daichi Shigeta, Noriko Kano, Xiao-Feng Lei, Joo-ri Kim-Kaneyama, Hiroyuki Minakata, Akira Miyazaki, Kazuyoshi Tsutsui. Expression of steroidogenic enzymes and metabolism of steroids in COS-7 cells known as non-steroidogenic cells, Scientific Reports, 2018, Issue: 8, DOI: 10.1038/s41598-018-20226-2