Reconstructing the phylogeny of Blattodea: robust support for interfamilial relationships and major clades

www.nature.com/scientificreports OPEN Received: 22 December 2016 Accepted: 11 May 2017 Published: xx xx xxxx Reconstructing the phylogeny of Blattodea: robust support for interfamilial relationships and major clades Zongqing Wang1, Yan Shi1, Zhiwei Qiu1, Yanli Che1 & Nathan Lo2 Cockroaches are among the most recognizable of all insects. In addition to their role as pests, they play a key ecological role as decomposers. Despite numerous studies of cockroach phylogeny in recent decades, relationships among most major lineages are yet to be resolved. Here we examine phylogenetic relationships among cockroaches based on five genes (mitochondrial 12S rRNA, 16S rRNA, COII; nuclear 28S rRNA and histone H3), and infer divergence times on the basis of 8 fossils. We included in our analyses sequences from 52 new species collected in China, representing 7 families. These were combined with data from a recent study that examined these same genes from 49 species, resulting in a significant increase in taxa analysed. Three major lineages, Corydioidea, Blaberoidea, and Blattoidea were recovered, the latter comprising Blattidae, Tryonicidae, Lamproblattidae, Anaplectidae, Cryptocercidae and Isoptera. The estimated age of the split between Mantodea and Blattodea ranged from 204.3 Ma to 289.1 Ma. Corydioidea was estimated to have diverged 209.7 Ma (180.5–244.3 Ma 95% confidence interval [CI]) from the remaining Blattodea. The clade Blattoidea diverged from their sister group, Blaberoidea, around 198.3 Ma (173.1–229.1 Ma). The addition of the extra taxa in this study has resulted in significantly higher levels of support for a number of previously recognized groupings. Cockroaches are considered to play a key role in terrestrial ecosystems, recycling dead plants, dead animals and excrement and contributing to ecosystem functioning via the breakdown of organic matter and the release of nutrients1. The morphologically and ecologically diverse group Blattodea including Isoptera is widely accepted to be a monophyletic2–13. In recent decades a number of studies have examined the phylogeny of Blattodea based on morphological characters6,14–16, molecular data3,7–9,11,13,17–19, or both10,12. Taken together, these studies displayed some consistent relationships, including Ectobiidae (=Blattellidae) being paraphyletic with respect to Blaberidae6,7,10–13,19, and Isoptera being placed within Blattodea as sister to Cryptocercidae (morphological methods6; molecular methods3,7,8,11,12,17,19; combined data10–12). The monophyly of termites and their closest relatives Cryptocercus is supported by strong synapomorphies, such as xylophagy, biparental care, proctodeal trophallaxis and a rich and highly specific hindgut fauna of flagellates20–22. Despite these advances, the evolutionary relationships among the main lineages of Blattodea have yet to be well resolved, and a number of other results from previous studies remain under discussion. These include: (i) the proposal that Tryonicidae and Lamproblattidae are given family status and excluded from Blattidae6; (ii) the proposed sister grouping between Nocticolidae and Corydiidae (=Polyphagidae)11; (iii) the sister group relationships between Lamproblattidae and Blattidae12; (iv) the sister group of Cryptocercidae + Isoptera, which may be either Tryonicidae, Anaplecta, or Tryonicidae + Anaplecta12. Although the Nocticolidae are generally accepted to be a monophyletic group, the placement of Nocticolidae and the relationships with Corydiidae have been debated over the last 20 years. Grandcolas15 proposed that Nocticolidae should be lowered to the subfamily level and be synonymised with Latindiinae. In most other 1 College of Plant Protection, Southwest University, Beibei, Chongqing, China. 2School of Life and Environmental Sciences, University of Sydney, Sydney, New South Wales, Australia. Correspondence and requests for materials should be addressed to N.L. (email: ) Scientific Reports | 7: 3903 | DOI:10.1038/s41598-017-04243-1 1 www.nature.com/scientificreports/ Genes 12S 12S 16S 16S COII COII 28S H3 Forward/ Reverse Primer name Sequence(5′-3′) Reference F 12S forward ATCTATGTTACGACTTAT Inward et al.7 R 12S reverse AAACTAGGATTAGATACCC Kambhampati23 F 12S F1or 12S F2 GATCATTCTAGTTACACCTTCC or GTACAACTACTGTGTTACGACT N/A R 12S reverse AAACTAGGATTAGATACCC Kambhampati23 F 16S Forward CGCCTGTTTAACAAAAACAT Simon et al.24 R 16S Reverse TTTAATCCAACATCGAGG Cognato et al.25 F 16S F1 GGAAGGTGTAACTAGAATGATC N/A R 16S R1 GATAGAAACCAACCTGGCTCAC N/A F COII-F AGAGCWTCACCTATTATAGAAC Park et al.26 R COII-R GTARWACRTCTGCTGCTGTTAC Park et al.26 F Modified A-tLeu CAGATAAGTGCATTGGATTT Miura et al.27 R B-tLys GTTTAAGAGACCAGTACTTG Simon et al.24 F Hux ACACGGACCAAGGAGTCTAAC Inward et al.7 R Win GTCCTGCTGTCTTAAGCAACC Inward et al.7 F H3 AF ATGGCTCGTACCAAGCAGACVGC Inward et al.7 R H3 AR ATATCCTTRGGCATRATRGTGAC Inward et al.7 Table 1. Primers used to generate sequences. N/A: primers were designed for this study. studies, Nocticolidae were recovered as the sister group to Corydiidae7,9,11,19. When additional Latindiinae taxa were included, Nocticolidae was recovered to be the sister group to Latindia + Paralatindia12,13. In this study, we sequenced three mitochondrial (12S rRNA, 16S rRNA and COII) genes and two nuclear (28S rRNA and Histone H3) genes from 52 blattarian (mainly Ectobiidae, Blaberidae and Blattidae) species collected in China, including representatives of three important genera: Anaplecta, Nocticola and Cryptocercus. Combining these sequences with previously published sequences, and using 8 fossils, we performed phylogenetic and divergence date analyses, and inferred the biogeographic history and timescale of evolution within Blattodea. Material and Methods DNA extraction, amplification, purification and sequencing. We sampled 5 genes of 52 species (Table S1) from Blattodea in this study: mitochondrial 12S rRNA, 16S rRNA, COII, nuclear 28S rRNA and Histone H3. Total DNA was extracted from hindleg tissues of samples preserved in 100% ethanol. The extraction procedure was according to the TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing). Fragments of 12S rRNA, 16S rRNA, COII, 28S rRNA and H3 were amplified using PCR. Primers for the amplifications of these partial genes are given in Table 1. For PCR amplification, a 25 μL cocktail of 1 μL DNA template, 15.25 μL double-distilled H2O (ddH2O), 2 μL MgCl2 (25 mM), 2.5 μL 10*PCR Loading Buffer, 0.25 μL Taq DNA polymerase (TakaRa DNA kit; 100 mM Tris-HCl, pH8.3, 500 mM KCl), 2 μL dNTP mixture (1 mM concentration of each dNTP) and 1 μL of each primer was used. The PCR conditions included are given in Table S2. The amplified products were electrophoresed in a 1% agarose gel. PCR products were used for sequencing. In the case where sequencing was not successful, purified PCR fragments were cloned and sequenced. All new sequences were checked for con (...truncated)