Three different ABCA4 mutations in the same large family with several consanguineous loops affected with autosomal recessive cone–rod dystrophy

European Journal of Human Genetics (2006) 14, 1269–1273 & 2006 Nature Publishing Group All rights reserved 1018-4813/06 $30.00 www.nature.com/ejhg ARTICLE Three different ABCA4 mutations in the same large family with several consanguineous loops affected with autosomal recessive cone–rod dystrophy Dominique Ducroq1, Stavit Shalev2, Aviv Habib2, Arnold Munnich1, Josseline Kaplan1 and Jean-Michel Rozet*,1 1 Unite de Recherches sur les Handicaps Génétiques de l’Enfants, Hôpital Necker-Enfants Malades, INSERM 393, 149 rue de Sèvres, Paris Cedex 15 75743, France; 2Genetic Institute of Ha’Emek Medical Center, Afula, Israel A large multiplex family presumably affected with autosomal recessive cone–rod dystrophy (CRD) was ascertained from Israel. In this family of Christian Arab ancestry with six consanguineous loops, linkage analysis failed to identify homozygosity in all six nuclear families at any of the three arCORD loci hitherto reported. However, homozygosity was found at the CORD3 locus for two nuclear families and the segregation of three distinct haplotypes at this locus in the whole pedigree suggested the alteration of the ABCA4 gene. This hypothesis was confirmed by the identification of three distinct mutations. Subsequently, with regard to the wide spectrum of autosomal recessive retinal dystrophies related to ABCA4 mutations, the natural history of the disease was revisited in all patients. Although the diagnosis of CRD was confirmed in 8/9 patients, the last one, aged of 34, displayed typical signs of Stargardt disease without extension to the peripheral retina. The results of this study emphasize the pitfalls of homozygosity mapping in highly inbred families when the heterozygote carrier frequency is particularly high in the general population. European Journal of Human Genetics (2006) 14, 1269–1273. doi:10.1038/sj.ejhg.5201691; published online 9 August 2006 Keywords: macular degeneration; ABCA4 (ABCR) gene; homozygosity mapping pitfalls Introduction The ABCA4 gene1,2 has been associated with several forms of inherited autosomal recessive retinal dystrophies (MIM 601691). Indeed, mutations in this retinal-specific ATPbinding cassette gene account for all cases of early- and late-onset autosomal recessive Stargardt disease (arSTGD; MIM 248200) and for the main part of autosomal recessive cone – rod dystrophies (arCRDs).3,4 Some mutations in ABCA4 have been reported in exceptional cases of retinitis pigmentosa (RP).5,6 *Correspondence: Dr J-M Rozet, Recherches sur les Handicaps Génétiques de l’Enfant, Hôpital Necker-Enfants Malades, INSERM 393, 149 rue de Sèvres, Paris Cedex 15 75743, France. Tel: þ 33 1 44 49 51 61; Fax: þ 33 1 44 49 51 50; E-mail: Received 2 December 2005; revised 26 May 2006; accepted 6 June 2006; published online 9 August 2006 A substantial allelic heterogeneity has been described (Human Gene Mutation Database). In addition, the carrier frequency of ABCA4 variants is particularly high in the general population, ranging from 1/50 to 1/10.7 – 9 Within the huge family of inherited retinal dystrophies, the CRD phenotype indicates a specific form of retinal degeneration in which the cone degeneration appears early in life with a central involvement of the retina, followed by the degeneration of rods several years later.9 This particular form of retinal dystrophy has been regarded as ‘inverse RP’ and can be misdiagnosed as macular dystrophy in the first stages of the disease. Indeed, the main symptoms of arCRD at disease onset are decrease of visual acuity, loss of color discrimination and photophobia. The b-wave of the photopic electroretinogram (ERG; cone response) is severely reduced, although the b-wave of the scotopic ERG is still normal. As the disease progresses, nyctalopia, ABCA4 mutations and autosomal recessive cone – rod dystrophy D Ducroq et al 1270 progressive peripheral visual field deficit and decreasing scotopic ERG amplitudes are observed. Here, we report the identification of three ABCA4 disease alleles in a large multiplex family from Israel with six consanguineous loops gathering nine patients affected with autosomal recessive retinal dystrophy. This study confirms that, in view of the high frequency of ABCA4 mutation carriers, the existence of more than one disease-causing mutation should be considered in consanguineous families. Patients and methods Patients A large multiplex family of Christian Arab ancestry affected with autosomal recessive retinal dystrophy was ascertained through the Genetic Institute of Ha’Emek Medical Center in Afula, Israel. This pedigree was made of six loops of consanguinity gathering nine affected members and seven healthy relatives. In a first step, individuals of only three of the six loops of the pedigree (L1 – L3; Figure 1) were addressed to the Laboratory. All affected patients of these three loops (III1, III2, IV1, IV2, IV4) underwent general and ophthalmologic examinations in Afula. All of them fulfilled the minimal criteria for the diagnosis of CRD10. In a second step, family members of three additional loops of the pedigree (L4 – L6; Figure 1), gathering four individuals considered as affected with the same disease, were addressed to the laboratory for genetic studies. Precise clinical data were requested for these last patients and obtained later on. Each family member’s blood was collected in Afula and analyzed in France. Linkage analysis at arCRD loci A linkage analysis was performed in this pedigree using markers containing short tracks of (CA)n repeats flanking each of the three hitherto known arCRD loci: AFMa051wg9 (D1S2868), AFM350tg9 (D1S2849) and AFM205ta11 (D1S236) at the CORD3 locus on chromosome 1p22 (MIM 604116); AFMa297  g9 (D1S2696), AFM234zd12 (D1S442), AFMa046wd9 (D1S2343), AFMa244wh5 (D1S2675) and AFM350yh1 (D1S2851) at the CORD8 locus on chromosome 1q12q24 (MIM 605549); and AFMb329we5 (D14S1023) and AFM312xh1 (D14S283) at the CORD9 locus on chromosome 11q11 (MIM 608194), respectively. All nucleotide sequences, allelic frequencies and distances between markers were available from Genethon linkage map11 and the Human Gene Mutation Database. In addition, intronic primers were designed to flank short tracks of nucleotide repeats in the ABCA4 and RPGRIP1 genes at the CORD3 and CORD9 loci, respectively. The nucleotide sequences of RPGRIP1 primers were available elsewhere.12 ABCA4 primer sequences were: Figure 1 Pedigree of a Christian Arab family of Israel and haplotypes at the CORD3 locus on chromosome 1p22.1. Three haplotypes segregate with the disease, each carrying a distinct ABCA4 mutation. M1: c.5460 þ 1G4A; M2:p.G1961E and M3:p.G1202R. The six loops of consanguinity of this pedigree are labelled L1 – L6, respectively. European Journal of Human Genetics ABCA4 mutations and autosomal recessive cone – rod dystrophy D Ducroq et al 1271 0 0 forward 5 TTAAGAGAACTTATTTGGCATAGGA3 ; reverse 50 CAAAGAACCGGAAGAGACTGT30 . Amplified fragments were elect (...truncated)