Phylogenetic and molecular characterization of chicken anemia virus in southern China from 2011 to 2012

OPEN SUBJECT AREAS: MOLECULAR EVOLUTION GENE AMPLIFICATION Phylogenetic and molecular characterization of chicken anemia virus in southern China from 2011 to 2012 Xinheng Zhang1, Yuanjia Liu3, Boliang Wu1, Baoli Sun1, Feng Chen1, Jun Ji1, Jingyun Ma1 & Qingmei Xie1,2 Received 22 August 2013 Accepted 28 November 2013 Published 17 December 2013 Correspondence and requests for materials should be addressed to Q.M.X. (qmx@scau. edu.cn) 1 College of Animal Science, South China Agricultural University, Guangzhou 510642, Guangdong, China, 2Key Laboratory of Chicken Genetics, Breeding and Reproduction, Ministry of Agriculture, Guangzhou 510642, China, 3College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China. Chicken anemia virus (CAV) is an important pathogen that causes severe immunosuppression in young chickens. We have characterized 13 CAVs isolated from different commercial farms in southern China between 2011 and 2012. We discovered 92 variable residues compared to 37 other CAV complete genome sequences from other parts of the world listed in GenBank; these residues have not been previously observed. All of the Chinese CAV genomes that were characterized in this study had a glutamine at position 394, a hallmark of highly pathogenic CAVs. We also discovered that intra-group genetic recombination plays a role in generating genetic diversity in natural populations of CAV. The GD-J-12 isolate was a possible recombinant between GD-C-12 and GD-M-12 in the genomic region that encompassed both the coding and non-coding regions. C hicken anemia virus (CAV) is a transmissible agent that produces severe anemia with aplasia of the bone marrow and atrophy of the lymphoid organs in susceptible chickens1. CAV causes severe anemia in newly hatched chickens and destruction of erythroblastoid cells in the bone marrow and thymocytes in the thymic cortex2. Some broiler flocks examined at the time of slaughter had antibodies against CAV, suggesting vertical and horizontal modes of transmission3,4. CAV isolates were thought to belong to a single serotype and were antigenically indistinguishable by serum neutralization tests5. In 2011, a new human virus, named human gyrovirus (HGyV) due to its homology with CAV, was identified on the surface of human skin6. CAV (JQ690762) was identified in pediatric fecal samples in Beijing, China, in 20127, and the genome had a 21-nt insertion (TCCGTACAGGGGGGTACGTCA) in comparison with the strain named GD-1-12 (accession no. JX260426), which was isolated in Southern China in 20128. As of 2012 in China, two gyrovirus species have been designated GyV3 and GyV4. GyV3 was detected in samples of diarrhea and normal feces from Chilean children in the USA, and these had a low level of sequence similarity with other gyroviruses, which may reflect the consumption of CAV-infected/vaccinated chickens9; GyV4 was identified in human stool and in chicken meat sold for human consumption in Hong Kong in 201210. In the same year, HGyV DNA was detected in four samples in Italy11. These data reflect the potential for CAV to threaten human health, especially after the consumption of infected or CAV-vaccinated chickens. CAV is distributed worldwide with variable prevalence, causing significant economic losses in the production of young birds. In China, CAV was first isolated in 199612. Ducatez confirmed a high prevalence of approximately 87% in live bird markets in Southeast China13. However, there are no reports to date on either the molecular characteristics or the complete genomic characterization of CAV in southern China. CAV has been classified under the genus Gyrovirus and the family Circoviridae14. CAV is a non-enveloped, icosahedral virus approximately 25 nm in diameter, with a negative-sense, single-stranded circular DNA genome approximately 2298 to 2319 nucleotides in length15. The genome consists of three major partially overlapping, open reading frames that encode for peptides of 51.6 (VP1), 24 (VP2) and 13.6 (VP3) kDa16. VP1 is the major viral structural protein, VP2 is a scaffolding protein and VP3 is a non-structural protein named apoptin. VP1 and VP2 are the protective proteins that induce neutralizing antibodies17. The VP1 gene has the highest variability of the three overlapping ORFs, according to sequences that have been submitted to GenBank18. Based on phylogenetic analyses of the entire coding regions of VP1, VP2 and VP3, the sequences were organized into four distinct groups (A–D) and five subgroups (A1, A2, A3, D1 and D2)19. Studies have confirmed that a hypervariable region spanning 13 amino acids in VP1 from position 139 to 151 affects viral growth and spread, especially residues SCIENTIFIC REPORTS | 3 : 3519 | DOI: 10.1038/srep03519 1 www.nature.com/scientificreports 139 and 144. These residues are believed to play major roles in this regard considering that VP1 Q139 and/or Q144 show a decreased capacity to spread20. Genetic diversity in Gyrovirus is due to adaptive evolution driven by high mutation rates and genetic recombination. Larger scale sequence changes can occur via the exchange of genetic information with other related viruses via the process of recombination21,22. Compared to other DNA viruses, Circoviridae appears to have relatively low rates of recombination. To date, only two studies have reported recombination in CAV. However, one was performed in 200723, while the other focused on the open reading frame structure and inter-subtype recombination analysis24. In the present study, we analyzed the complete genome sequences of CAV from different geographical locations in GenBank in order to gain insights into the presence of recombination among CAV strains. The genetic and recombination characterization of CAVs from different geographical locations is pivotal to our understanding of CAV evolution. Results Virus detection and isolation. Thirteen viruses were identified as CAV from fifteen thymus and eight spleen samples by PCR analyses. The 13 CAVs were submitted to virus isolation in vitro in MDCCMSB1 cells. After cells were cultured 3 days, we harvested the viruses, and their presence was confirmed by PCR analysis with the NC1 and NC2 primers. Accordingly, all thirteen viruses were confirmed to be present. Among the 13 CAVs, the nine strains (GD-C-12,GD-D-12, GD-E-12,GD-F-12,GD-H-12,GD-J-12,GD-L-12,GD-M-12,GD-N-12) were isolated in Guangdong province, China, 2012. The GD-B-12 and GD-I-12 strains were isolated in Guangxi province, China, 2011. The GD-G-12 strain was isolated in Hainan province, China, 2011 and the GD-K-12 strain was isolated in Hainan province, China, 2012. PCR amplification of the complete genome of CAVs. PCR amplification of the complete genome of 13 positive CAV isolates using primers CQ1F and CQ1R yielded a specific 1,778 bp product, and the CQ2F and CQ2R primers yielded a specific 831 bp product as expected. Sequence accession numbers. The CAV genome sequences characterized (...truncated)