Construction and Characterization of Adenovirus Vectors Encoding Aspartate-β-Hydroxylase to Preliminary Application in Immunotherapy of Hepatocellular Carcinoma

Hindawi Journal of Immunology Research Volume 2018, Article ID 9832467, 10 pages https://doi.org/10.1155/2018/9832467 Research Article Construction and Characterization of Adenovirus Vectors Encoding Aspartate-β-Hydroxylase to Preliminary Application in Immunotherapy of Hepatocellular Carcinoma Yujiao Zhou ,1 Feifei Liu,2 Chengmin Li,3 Guo Shi,4 Xiaolei Xu,1 Xue Luo,1 Yuanling Zhang,1 Jingjie Fu,1 Aizhong Zeng ,1 and Limin Chen 5 1 Department of Infectious Disease, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China Department of Infectious Disease, The People’s Hospital of Deyang City, Deyang, Sichuan Province 618000, China 3 Department of Infectious Disease, The Chongqing Fuling Center Hospital, Chongqing 400016, China 4 Department of General Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China 5 Toronto General Research Institute, University of Toronto, Toronto, ON, Canada 2 Correspondence should be addressed to Aizhong Zeng; Received 25 January 2018; Accepted 30 May 2018; Published 15 July 2018 Academic Editor: Feng Li Copyright © 2018 Yujiao Zhou et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Dendritic cells (DCs) harboring tumor-associated antigen are supposed to be a potential immunotherapy for hepatocellular carcinoma (HCC). Aspartate-β-hydroxylase (AAH), an overexpressed tumor-associated cell surface protein, is considered as a promising biomarker and therapeutic target for HCC. In this study, we constructed adenovirus vector encoding AAH gene by gateway recombinant cloning technology and preliminarily explored the antitumor effects of DC vaccines harboring AAH. Firstly, the total AAH mRNA was extracted from human HCC tissues; the cDNA was amplified by RT-PCR, verified, and sequenced after TA cloning. Gateway technology was used and the obtained 18T-AAH was used as a substrate, to yield the final expression vector Ad-AAH-IRES2-EGFP. Secondly, bone marrow-derived DCs were infected by Ad-AAH-IRES2-EGFP to yield AAH-DC vaccines. Matured DCs were demonstrated by increased expression of CD11c, CD80, and MHC-II costimulatory molecules. A dramatically cell-killing effect of T lymphocytes coculturing with AAH-DCs on HepG2 HCC cell line was demonstrated by CCK-8 and FCM assays in vitro. More importantly, in an animal experiment, the lysis effect of cytotoxic T lymphocytes (CTLs) on HepG2 cells in the AAH-DC group was stronger than that in the control groups. In conclusion, the gateway recombinant cloning technology is a powerful method of constructing adenovirus vector, and the product Ad-AAHIRES2-EGFP may present as a potential candidate for DC-based immunotherapy of HCC. 1. Introduction Hepatocellular carcinoma (HCC) is a common malignant tumor, and despite curable strategies such as resection or liver transplantation, patients with advanced HCC continue to present a poor outcome [1, 2]. Although sorafenib has been shown to improve survival of advanced HCC patients, it ultimately failed to show any improvement in outcomes for the treatment of HCC in randomized studies. The clinical trials of new drugs including lenvatinib, regorafenib, and pembrolizumab have shown promise; however, more convictive clinical evidences are still needed [3]. Therefore, there is a clear need for new therapeutic approaches for HCC. Aspartate-β-hydroxylase (AAH) is a highly conserved type II transmembrane protein and a kind of α-ketoglutarate-dependent dioxygenase. Currently, AAH has been found highly expressed in a variety of human malignancies including HCC, cholangiocellular carcinoma, and breast, pancreatic, and non-small lung cancer [4–7]; however, it is rarely expressed in normal tissues and lowly expressed in tumor-adjacent tissues [4]. Previous researches have demonstrated that overexpression of AAH strikingly increases 2 Journal of Immunology Research Table 1: PCR primer sequences of the AAH gene for DNA ligating. Sequence (5′→3′) Amplification fragments ATCATCCTCGAGGCCACCATGGCCCAGCGTAAGAATGCCAAG ATCATCGGATCCCTAAATTGCTGGAAGGCTGCGTCTCTGCT 2277 bp Primer name AAH-F AAH-R Table 2: PCR primers for AAH and IRES2-EGFP fusion. Sequence (5′→3′) Primer name attB1-AAH IRES2-AAH-2277R AAH-IRES2-1F attB2-EGFP GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGCCACCATGGCCCAGCGTAAGAATGCCAAGAGC GTTAGGGGGGGGGGAGGGAGAGGGGCCTAAattGCTGGAAGGCTGCGTCTCTGCT AGCAGAGACGCAGCCTTCCAGCAattTAGGCCCCTCTCCCTCCCCCCCCCCTAAC GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAGAGTG motility and invasiveness of HCC cell lines [8]. Xian et al. [9] reported that AAH overexpression was detected in 150 of 161 patients with HCC, and higher expression levels of AAH correlated significantly with the presence of intrahepatic metastasis and the progression of histological grades. Another clinical study showed that overexpression of AAH is associated with worse clinical outcomes in HCC patients after surgery [10]. The research of Aihara et al. [11] has demonstrated that small molecule inhibitors of AAH produce antitumor effect in HCC. As a conclusion, AAH could be considered as a prognostic maker and therapeutic target for HCC. After forty years of research, it is generally realized that dendritic cells (DCs), the most powerful professional antigen-presenting cells, are the center part of the immune system, because of their ability to control both immune tolerance and immunity. The application of DCs loaded with tumor-associated antigen (TAA) is supposed to be a promising approach in the prophylaxis and therapy of malignant tumors. The prophylactic and therapeutic effect of DCmediated tumor vaccines has been successfully confirmed in mouse models. Besides, the history of application of therapeutic DC vaccines in cancer patients has been more than a decade. To date, several new-type DC vaccines have successfully gained entry to phase III clinical trials; however, the most appropriate indication for these vaccines is melanoma [12]. Delivering TAA into DCs in vitro needs the help of vectors. Diverse tools including cytoplasmic transduction peptide delivery system, microbial components, plasmids, and virus have been developed [13–16]. In this study, our aim was to construct a novel adenovirus (Ad) vector encoding AAH gene and to preliminarily explore the potential antitumor activity of DCs loaded with AAH against HCC. 2. Materials and Methods 2.1. Primer Designing and Polymerase Chain Reaction (PCR) Amplification of DNA Fragments. Primers (Table 1) were synthesized according to the human AAH gene sequence (GenBank accession number 004318) and obtained commercially from the manufacturer (Invitrogen, USA, HG1606160040). Total mRNA was extracted from human HCC tissues (supplied by the Hepatobiliary Surgery Department of the First Affiliated Hospital of Chongqing Medical University). PCR amplification (...truncated)