MLVA distribution characteristics of Yersinia pestis in China and the correlation analysis

Xiaoai Zhang 1 Rong Hai 1 Jianchun Wei 1 Zhigang Cui 1 Enmin Zhang 1 Zhizhong Song 0 Dongzheng Yu 1 0 Yunnan Institute for Endemic Disease Control and Prevention , Dali 671000, Yunnan , PR China 1 National Institute for Communicable Disease Control and Prevention, and State Key Laboratory for Infectious Disease Prevention and Control, Chinese Center for Disease Control and Prevention , P. O. Box 5, Changping, Beijing 102206 , PR China Background: Yersinia pestis, the aetiological agent of plague, has been well defined genotypically on local and worldwide scales. In November 2005, five cases of severe pneumonia of unknown causes, resulting in two deaths, were reported in Yulong, Yunnan province. In this study, we compared Y. pestis isolated from the Yulong focus to strains from other areas. Results: Two hundred and thirteen Y. pestis strains collected from different plague foci in China and a live attenuated vaccine strain of Y. pestis (EV76) were genotyped using multiple-locus variablenumber tandem repeat analysis (MLVA) on 14 loci. A total of 214 Y. pestis strains were divided into 85 MLVA types, and Nei's genetic diversity indices of the various loci ranged between 0.02 - 0.76. Minimum spanning tree analysis showed that Y. pestis in China could be divided into six complexes. It was observed that Microtus strains were different from the other three biovar strains. Each plague focus had its own unique MLVA types. Conclusion: The strains isolated from Yulong, Yunnan province had a unique MLVA type, indicating a new clone group. Our results suggest that Yulong strains may have a close relationship with strains from the Qinghai-Tibet Plateau plague focus. - Background Plague is an infectious disease caused by Yersinia pestis, a naturally occurring bacterium found primarily in wild rodents. It is highly transmissible and brings a high mortality, leading to major public health disasters throughout the history of humanity [1]. In the early 1990s, the incidence of human plague increased significantly [2], with outbreaks occurring in Africa [3] and India [4]. WHO has classified plague as a reemerging infectious disease for the past 20 years, and Y. pestis has been identified as a bioterrorism agent, posing as a significant threat to human health and safety [5]. In November 2005, a natural focus of human plague was discovered in Yulong, Yunnan province, China[6]. In this study, we compared Y. pestis isolated from the Yulong focus to strains from other areas. Y. pestis couldn't be separated by serotype and phage-type, but could be classified into three biovars: Antiqua, Mediaevalis and Orientalis, according to their ability to ferment glycerol and to reduce nitrate as described by Devignat in the 1950s [7]. Recently, a new biovar Microtus was proposed based on whole genome sequencing and genetic analysis [8,9]. Y. pestis has a broad host and vector range [10]. These hosts and vectors have their own natural environment, resulting in the diversity of micro-ecological environments for Y. pestis. During its expansion and adaption into new niches, Y. pestis undergoes considerable genome variability in response to natural selection. This variability can partly explain the genomic diversity of strains from different plague foci [11]. At present, natural plague foci are widespread inChina. Through systematic analysis of Y. pestis in these areas, it is possible to understand the evolution of Y. pestis and investigate the source of new plague foci. Previous studies have revealed a large number of tandem repeat sequences (TRSs) in the Y. pestis genome, and these TRSs introduce diversity into various plague strains [12]. These loci are called variable-number tandem repeats (VNTRs). Multiple-locus VNTR analysis (MLVA) is an individual identification method that detects VNTR loci. MLVA is widely used in Y. pestis genotyping, and is useful for performing phylogenetic analysis [12-16]. In this study, 213 Y. pestis strains collected from different plague foci in China and a live attenuated vaccine strain of Y. pestis (EV76) were genotyped by MLVA using 14 loci. Methods Bacterial strains and DNA preparation A total of 214 Y. pestis strains were included in this study. 208 strains were isolated from 13 natural plague foci in China between 1952 and 2002, an additional five strains were isolated from Yulong Yunnan in 2006, and the EV76 strain was also included in this study (Table 1). The bactePlague focus in China Focus designation in this study Geographical origin Year No. of isolates tested Marmota caudate Plague Focus of the Pamirs Plateau Marmota baibacina-Spermophilus undulates Plague Focus of the Tianshan Mountains Marmota himalayana Plague Focus of the Qinghai-Gansu-Tibet Grassland Marmota himalayana Plague Focus of the Qilian Mountain Apodemus chevrieri-Eothenomys miletus Plague Focus of the highland of Northwestern Yunnan Province Rattus flavipectus Plague Focus of the YunnanGuangdong-Fujian provinces Marmota himalayana Plague Focus of the Gangdisi Mountains Spermophilus dauricus Plague Focus of the Song-Liao Plain Meriones unguiculatus Plague Focus of the Inner Mogolian Plateau Spermophilus dauricus alaschanicus Plague Focus of the Loess Plateau in Gansu and Ningxia provinces Marmota himalayana Plague Focus of the Kunlun Mountains Yunnan, Guizhou Inner Mongolia, Jilin 1953-1970 10 Inner Mongolia, Hebei 1970-1995 8 1962-1978 9 1956-1997 10 1958-1998 12 1956-1994 20 1975-1987 6 1954-1997 38 1958-2001 20 1954-1994 12 1952-2002 22 1966-1998 13 1972-1979 6 1997-2001 10 ria were cultivated in Hottinger's medium at 28C for 24 - 36 h, and then the genome DNAs were extracted by using conventional SDS lysis and phenol-chloroform extraction method. The bacterial culture and extraction of DNAs were performed in biosafety level 3 (BSL-3) laboratories. VNTR locus selection A total of 14 VNTR loci with core sequences >9 bp were selected from previously described VNTR loci [12,17] (Table 2). The 14 VNTR loci had shown at least two alleles in six sequenced strains of Y. pestis (CO92, KIM, 91001, Nepal516, Antiqua, Angola). In order to provide an assay that is useful and widely accessible to research and public health laboratories, the present investigation favors markers with relatively large repeat units. VNTR analysis MLVA was performed as previously described [12]. The loci and corresponding PCR primers were listed in Table 2. PCR reactions were prepared in a 20 l volume with 10 PCR buffer, 0.5 U Taq polymerase, 200 M each of the four dNTPs, 10 M each primer set, 1 ng template DNA and filtered sterile water. PCR conditions were as follows: initial denaturation at 94C for 5 min, and then 35 cycles of 94C for 20 s, 60C for 20 s and 72C for 45 s, followed by a final polymerase extension step at 72C for Locus Core sequence TGTGGTGATCTAAGCGCAACACA GTTAAAAACAGATTTTAA AATGCCTATTCCTCTGACAGAAT CCGTATC TTCATAGCTTCTATTATAGAGA ATTTACGGTATAGCTACTGA TTTCAAGCTGAATGTGTG M76 ms01 TGCAGTGAAAAGGTTAAC TTA (...truncated)