Attenuated Salmonella typhimurium delivering DNA vaccine encoding duck enteritis virus UL24 induced systemic and mucosal immune responses and conferred good protection against challenge

Yu et al. Veterinary Research 2012, 43:56 http://www.veterinaryresearch.org/content/43/1/56 RESEARCH VETERINARY RESEARCH Open Access Attenuated Salmonella typhimurium delivering DNA vaccine encoding duck enteritis virus UL24 induced systemic and mucosal immune responses and conferred good protection against challenge Xia Yu1,2†, Renyong Jia1,2,3*†, Juan Huang1,2†, Bin Shu1,2†, Dekang Zhu1,2, Qing Liu3, Xinghong Gao1,2, Meng Lin1,2, Zhongqiong Yin3, Mingshu Wang1,2,3, Shun Chen1,2,3, Yin Wang3, Xiaoyue Chen1,2 and Anchun Cheng1,2,3* Abstract Orally delivered DNA vaccines against duck enteritis virus (DEV) were developed using live attenuated Salmonella typhimurium (SL7207) as a carrier and Escherichia coli heat labile enterotoxin B subunit (LTB) as a mucosal adjuvant. DNA vaccine plasmids pVAX-UL24 and pVAX-LTB-UL24 were constructed and transformed into attenuated Salmonella typhimurium SL7207 resulting SL7207 (pVAX-UL24) and SL7207 (pVAX-LTB-UL24) respectively. After ducklings were orally inoculated with SL7207 (pVAX-UL24) or SL7207 (pVAX-LTB-UL24), the anti-DEV mucosal and systemic immune responses were recorded. To identify the optimum dose that confers maximum protection, we used different doses of the candidate vaccine SL7207 (pVAX-LTB-UL24) during oral immunization. The strongest mucosal and systemic immune responses developed in the SL7207 (pVAX-LTB-UL24) (1011 CFU) immunized group. Accordingly, oral immunization of ducklings with SL7207 (pVAX-LTB-UL24) showed superior efficacy of protection (60-80%) against a lethal DEV challenge (1000 LD50), compared with the limited survival rate (40%) of ducklings immunized with SL7207 (pVAX-UL24). Our study suggests that the SL7207 (pVAX-LTB-UL24) can be a candidate DEV vaccine. Introduction Duck viral enteritis (DVE, also called duck plague), caused by Anatid herpesvirus 1 (Duck enteritis virus, DEV), is an acute, contagious viral disease of ducks, geese and swans, accounting for a high mortality rate in ducks and decreased egg production, leading to heavy economic losses [1–4]. The symptoms of this disease include vascular damage, eruptions at specific locations on the mucosal surface of the gastrointestinal tract, lesions * Correspondence: ; † Equal contributors 1 Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, People's Republic of China 2 Avian Disease Research Center, College of Veterinary Medicine of Sichuan Agricultural University, 46 Xinkang Road, Ya’an, Sichuan 625014, People's Republic of China Full list of author information is available at the end of the article of lymphoid organs and degenerative sequelae in parenchymatous organs [5]. Immunization of ducks is an efficient way to prevent DEV infection [6,7]. The commonly used DEV attenuated live vaccine, provides a good protection against DEV infection [8]. However, the production and supply of the vaccine is insufficient, considering the large number of domestic and wild ducks [6]. Additionally, sometimes this vaccine fails to protect ducks after intramuscular or subcutaneous vaccination and, because it is grown in chick embryos, it may harbor other infectious agents such as H5N1 [6,9]. Therefore, a novel and more effective vaccine to protect against DEV infection is urgently required. Recently, some enteropathogenic bacteria [10] have been used as effective carriers for DNA vaccine including attenuated strains of Listeria monocytogenes [11], Salmonella spp [12] and Shigella © 2012 Yu et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Yu et al. Veterinary Research 2012, 43:56 http://www.veterinaryresearch.org/content/43/1/56 spp [13]. These bacteria are attractive vectors to deliver DNA vaccines to immunological inductive sites at mucosal surfaces and antigen-presenting cells (APC), which can improve mucosal and systemic responses against pathogens [14,15]. Amongst these bacteria, attenuated Salmonella has been extensively studied [15,16]. However, the use of attenuated Salmonella typhimurium as a DNA vaccine carrier in DEV has not yet been reported. A few antigens derived from pathogenic microorganisms, such as Escherichia coli heat-labile enterotoxin (LT), can be used as adjuvants to improve systemic and mucosal responses [17]. The nontoxic B subunit (LTB) is commonly used for this purpose [18,19]. These strategies of DNA vaccine combined with adjuvant might provide new opportunities in the development of DEV vaccine. DEV was classified as a separate genus of the Alphaherpesvirinae subfamily in the Herpesviridae family [1,2]. One gene UL24, is considered to be a core herpesvirus gene and is conserved among most of the herpes viruses [20,21], and null mutations or mutations in the conversed regions of UL24 can confer a syncytial phenotype and result in decreased viral yields in cultured cells, indicating that UL24 is important for efficient viral Page 2 of 10 replication [22,23]. In addition, UL24 protein has the ability to elicit a specific antibody response [24]. In this study, we used LTB as an adjuvant fused to UL24 gene and the attenuated S. typhimurium aroAstrain SL7207 as a vector to deliver DEV DNA vaccines. The results indicate that oral immunization of the recombinant S. typhimurium could induce specific immune response against DEV. Materials and methods Bacterial strains, plasmids, experimental ducklings Eukaryotic expression pVAX1 (Invitrogen, Carlsbad, California, USA), which contains the cytomegalovirus (CMV) promoter and bovine growth hormone (BGH) poly A signal, and enterotoxigenic E. coli K88ac were generously provided by Professor Sanjie Cao of Sichuan Agricultural University, China. The attenuated S. typhimurium aroA- strain SL7207 (S. typhimurium 2337–65 derivative hisG46, DEL407 [aroA::Tn10 (Tcs)]) was kindly provided by Professor Kai Schulze of Helmholtz Centre for Infection Research (Germany). 7-day-old Tianfu ducklings were purchased from commercial duck farms (Ya’an, China) and fed under standard conditions. Figure 1 A schematic diagram of the construction of pVAX-UL24 and pVAX-LTB-UL24. A schematic diagram of UL24 gene cloned into the pVAX-1 vector and a schematic diagram of LTB gene cloned into the recombinant plasmid pVAX-UL24. Yu et al. Veterinary Research 2012, 43:56 http://www.veterinaryresearch.org/content/43/1/56 Construction of expression plasmids E. coli K88ac genomic DNA was extracted using cetyl trimethylammonium bromide (CTAB) [25]. According to the DNA sequence of LTB published in GenBank (Accession:EU113245.1), the primers were designed (p1: 5’- TTAAACTTAAGCTTATGAATAAAGTAAAATGT3’, p2: 5’-GAATTCGTTTTCCATACTGATTGC-3’) to amplify the LTB gene containing a HindIII site (underlined) in primer 1 an (...truncated)