Overexpression of SIRT1 promotes metastasis through epithelial-mesenchymal transition in hepatocellular carcinoma

BMC Cancer Overexpression of SIRT1 promotes metastasis through epithelial-mesenchymal transition in hepatocellular carcinoma Chong Hao 1 Peng-Xi Zhu 0 Xue Yang 1 Zhi-Peng Han 1 Jing-Hua Jiang 1 Chen Zong 1 Xu-Guang Zhang 1 Wen-Ting Liu 1 Qiu-Dong Zhao 1 Ting-Ting Fan 1 Li Zhang 0 Li-Xin Wei 1 0 Department of Pharmacy, Chang Hai Hospital, the Second Military Medical University , 168 Changhai Road, Shanghai 200433 , China 1 Tumor Immunology and Gene Therapy Center, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University , 225 Changhai Road, Shanghai 200438 , China Background: SIRT1 is a member of the mammalian sirtuin family with the ability to deacetylate histone and nonhistone proteins. The correlation between SIRT1 expression and tumor metastasis in several types of cancer has aroused widespread concern. This study investigated SIRT1 expression and its prognostic value in hepatocellular carcinoma (HCC). The function of SIRT1 in hepatocarcinogenesis was further investigated in cell culture and mouse models. Methods: Western blotting and immunohistochemistry were used to explore SIRT1 expression in HCC cell lines and primary HCC clinical specimens. The functions of SIRT1 in the migration and invasion in the HCC cell line were analyzed by infecting cells with adenovirus containing full-length SIRT1 or sh-RNA. The effect of SIRT1 on tumorigenicity in nude mice was also investigated. Results: SIRT1 expression was significantly overexpressed in the tumor tissues and HCC cell lines. SIRT1 significantly promoted the ability of migration and invasion in HCC cells. In addition, experiments with a mouse model revealed that SIRT1 overexpression enhanced HCC tumor metastasis in vivo. Furthermore, we demonstrated that SIRT1 significantly enhanced the invasive and metastatic potential by inducing epithelial-mesenchymal transition in HCC cells. A clinicopathological analysis showed that SIRT1 expression was significantly correlated with tumor size, tumor number, and TNM staging. Kaplan-Meier survival curves revealed that positive SIRT1 expression was associated with poor prognosis in patients with HCC. Conclusions: Our data suggest that SIRT1 may play an important role in HCC progression and could be a potential molecular therapy target for HCC. SIRT1; Human hepatocellular carcinoma; Metastasis; Epithelial-mesenchymal transition - Background Liver cancer is the fifth most frequently diagnosed cancer and the second leading cause of cancer deaths worldwide. In general, the highest incidence rates are estimated to occur in Asia and Africa. Of all liver cancers, hepatocellular carcinoma (HCC) is the most common primary liver malignancy in adults, accounting for 70 85% of cases [1]. Modifiable risk factors, including chronic hepatitis B virus or hepatitis C virus infection, aflatoxin B1, and alcohol are thought to be the main causes of HCC [1]. HCC is an insidious disease without pain, the diagnosis of which is usually made at a late stage; thus, excluding curative treatments and leaving patients with few therapeutic options. The high mortality from HCC is mainly attributed to the invasion pattern and intrahepatic and/or extrahepatic metastases, but the exact mechanism remains unclear. Therefore, a thorough understanding of the underlying mechanisms of tumor metastasis is vital for effective prevention and therapeutics in the field of liver cancer research. Sirtuins in mammals share extensive homologies with the Sirt2 gene in yeast and comprise a small family with seven members, respectively named SIRT1SIRT7, which play a critical role in the regulation of critical biological processes such as metabolism, aging, oncogenesis, and cancer progression [2,3]. Notably, SIRT1 is the most well-characterized member of the sirtuin family and plays a key role in both cell death and survival with other p53 family members, FOXO transcription factors, and the nuclear factor-B family [4]. Moreover, whether SIRT1 acts as a tumor promoter or tumor suppressor remains controversial. It has been reported that SIRT1 is upregulated in a spectrum of cancers, including lymphomas, leukemia and soft-tissue sarcomas, prostate cancer, lung cancer, and colon carcinoma via one or more of these targets [5-9]. However, a significant decrease in SIRT1 expression is observed in breast cancer 1associated breast cancer than in normal controls [10]. A high level of SIRT1 expression was detected in 40 paired HCC tissues, compared with normal tissue, suggesting that SIRT1 may play a role in telomeric maintenance and genomic stability [11]. The role of SIRT1 in HCC is of particular interest for developing SIRT1 as a promising therapeutic target. In this study, we examined SIRT1 expression in HCC cell lines and human HCC tissue samples. The correlations among SIRT1 expression, clinicopathological variables, and survival time of patients with HCC were evaluated, and the role of SIRT1 in HCC prognosis was assessed. We uncovered a key role for SIRT1 as a tumor promoter that enhances invasive and metastatic potential in HCC using HCC cell models. Our findings provide a rationale for clinically exploring the use of sirtuin inhibitors in HCC therapy. Methods Cell culture The human hepatocellular carcinoma cell lines HepG2, Huh7, Hep3B, and SMMC-7721 were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences, Shanghai Institute of Cell Biology, Chinese Academy of Sciences. HepG2, Huh7, Hep3B, and SMMC-7721 cells were cultured in Dulbeccos modified Eagles medium (high glucose) (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS) and 100 U/ml of penicillin/streptomycin (Gibco). All cells were incubated in a humidified incubator at 37C with 5% CO2 and 95% air. RNA extraction and real-time quantitative PCR Total RNA extraction, complementary DNA (cDNA) synthesis, and qPCR were performed as described previously [12]. The primer sequences used in the qPCR are shown in Table 1. Table 1 Sequences of RT-PCR oligonucleotide primers Sequence (5 3) TGAAGGTGACAGAGCCTCTGGA Protein extraction and Western blotting analysis Total soluble protein extractions from cultivated cells and Western blot analyses were performed as described previously [12]. Antibodies used for Western blotting were specific for SIRT1. Immunohistochemistry After fixing the tissues in formalin and embedding them in paraffin, 4-m sections of the 99 HCCs from both tumor and nontumor tissues were deparaffinized in xylene, rehydrated in an alcohol series, and washed in distilled water. After treatment by microwave antigen retrieval, the sections were incubated with Block serumFree (Dako, Carpentaria, CA, USA) for 10 min at room temperature to inhibit non-specific staining. Then, the slides were incubated with anti-SIRT1 (Abcam, Cambridge, MA, USA; ab32441) antibody in a moist chamber overnight at 4C. Peroxidase activity was detected using the enzyme substrate 3,3 N-diaminobenzidine tertrahydrochlorid (...truncated)