Cytosolic CARP Promotes Angiotensin II- or Pressure Overload-Induced Cardiomyocyte Hypertrophy through Calcineurin Accumulation

et al. (2014) Cytosolic CARP Promotes Angiotensin II- or Pressure Overload-Induced Cardiomyocyte Hypertrophy through Calcineurin Accumulation. PLoS ONE 9(8): e104040. doi:10.1371/journal.pone.0104040 Cytosolic CARP Promotes Angiotensin II- or Pressure Overload-Induced Cardiomyocyte Hypertrophy through Calcineurin Accumulation Ci Chen 0 Liang Shen 0 Shiping Cao 0 Xixian Li 0 Wanling Xuan 0 Jingwen Zhang 0 Xiaobo Huang 0 Jianping Bin 0 Dingli Xu 0 Guofeng Li 0 Masafumi Kitakaze 0 Yulin Liao 0 Ryuichi Morishita, Osaka University Graduate School of Medicine, Japan 0 1 State Key Laboratory of Organ Failure Research, Department of Cardiology, Nanfang Hospital, Southern Medical University , Guangzhou , China , 2 Department of Pharmacy, Nanfang Hospital, Southern Medical University , Guangzhou , China , 3 Cardiovascular Division of the Department of Medicine, National Cerebral and Cardiovascular Center , Osaka , Japan The gene ankyrin repeat domain 1 (Ankrd1) is an enigmatic gene and may exert pleiotropic function dependent on its expression level, subcellular localization and even types of pathological stress, but it remains unclear how these factors influence the fate of cardiomyocytes. Here we attempted to investigate the role of CARP on cardiomyocyte hypertrophy. In neonatal rat ventricular cardiomyocytes (NRVCs), angiotensin II (Ang II) increased the expression of both calpain 1 and CARP, and also induced cytosolic translocation of CARP, which was abrogated by a calpain inhibitor. In the presence of Ang-II in NRVCs, infection with a recombinant adenovirus containing rat Ankrd1 cDNA (Ad-Ankrd1) enhanced myocyte hypertrophy, the upregulation of atrial natriuretic peptide and b-myosin heavy chain genes and calcineurin proteins as well as nuclear translocation of nuclear factor of activated T cells. Cyclosporin A attenuated Ad-Ankrd1-enhanced cardiomyocyte hypertrophy. Intra-myocardial injection of Ad-Ankrd1 in mice with transverse aortic constriction (TAC) markedly increased the cytosolic CARP level, the heart weight/body weight ratio, while short hairpin RNA targeting Ankrd1 inhibited TACinduced hypertrophy. The expression of calcineurin was also significantly increased in Ad-Ankrd1-infected TAC mice. Olmesartan (an Ang II receptor antagonist) prevented the upregulation of CARP in both Ang II-stimulated NRVCs and hearts with pressure overload. These findings indicate that overexpression of Ankrd1 exacerbates pathological cardiac remodeling through the enhancement of cytosolic translocation of CARP and upregulation of calcineurin. - Funding: This work was supported by grants from the National Natural Science Foundation of China (81170146, 31271513 to Y.L.), the Team Program of Natural Science Foundation of Guangdong Province, China (S2011030003134, to Y.L. and B.J.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. Cardiac ankyrin repeat protein (CARP) binds to various proteins, such as titin/connectin, myopalladin [1], and calsequestrin [2], and it plays a critical role in the maintenance of sarcomere integrity, stretch sensing, and excitation-contraction coupling under physiological and pathological conditions. Similar to the genes for natriuretic peptides and b-myosin heavy chain (b-MHC), the gene for CARP (termed ankyrin repeat domain 1: Ankrd1) was also identified as a fetal gene, expression of which is augmented in both animals and humans with cardiac hypertrophy [3,4] and heart failure (HF) [5,6]. Natriuretic peptides have been shown to have cardioprotective effect [7]. In contrast, the role of Ankrd1/ CARP in cell growth remains controversial. Although there is clinical evidence that Ankrd1 mutations are involved in the pathogenesis of hypertrophic and dilated cardiomyopathy [810], there is no consensus about whether CARP enhances or attenuates cardiac hypertrophy. Subcellular distribution of CARP is thought to be associated with its different function [11], while the cytosolic protease calpain 3 has been reported to be responsible for cytosolic retention of CARP [12]. It appears that Ankrd1/CARP can function as prohypertrophic gene in the myofibril by gain of function and as an anti-hypertrophic gene in the nucleus by suppression of cardiac genes expression [11,13]. A recent study revealed that hypertrophic cardiomyopathy (HCM) associated mutations in Ankrd1 (P52A, T123M, and I280V) have an increased binding ability of CARP to titin and myopalladin [9], while overexpression of either wildtype or HCM related mutant Ankrd1 (P52A or I280V) in cardiomyocytes reduced myocyte contractility [14]. In addition, it has been proposed that calpains influence signaling pathways that are involved in myocardial hypertrophy, including those for calcineurin [15,16]. Therefore, we postulated that an increased cytosolic translocation of CARP could be a mediator of calpainrelated signal transduction processes. Moreover, CARP is involved in calcium-dependent signaling [2], while increased binding of CARP to titin and myopalladin has been suggested to induce Forward primer (5939) CGGGATCCATGATGGTTTTTCGAGTAGAGG AGCCTTCGCTCACTCCACTA ACCAACTGCTTAGCCCCCC myocardial hypertrophy [9]. These findings suggest the hypothesis that CARP might accelerate the progression of cardiac hypertrophy. Although substantial evidence indicates that evaluation of Ankrd1/CARP expression may be helpful for diagnostic or prognostic assessment of cardiac hypertrophy, it is unknown whether Ankrd1/CARP could also be a therapeutic target. Considering that overproduction of angiotensin II (Ang II) is responsible for cardiac hypertrophy and upregulation of Ankrd1/ CARP, it seems reasonable for Ankrd1/CARP to be a potential target of Ang II receptor 1 blockers (ARB). Accordingly, we used Ang II-stimulated cultured cardiomyocytes and mice with transverse aortic constriction (TAC) to examine the following issues: (1) the influence of Ankrd1/CARP on cardiac hypertrophy; (2) whether Ankrd1/CARP modulates calcineurin and nuclear factor of activated T cells (NFAT) and (3) whether the ARB olmesartan medoxomil prevents the upregulation of Ankrd1/ CARP in response to Ang II or pressure overload. Materials and Methods All procedures were performed in accordance with our Institutional Guidelines for Animal Research and the investigation conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised in 1996). The study was approved by the ethics review board of Southern Medical University. The concentrations or dose of olmesartan and its active form RNH6270 were decided according to previous reports [17] and our preliminary experiments. Cell culture The neonatal rats were sacrificed by 2% isoflurane inhalation and cervical dislocation. Isolation and culture of ventricular (...truncated)