Left and Right Ventricle Late Remodeling Following Myocardial Infarction in Rats

et al. (2013) Left and Right Ventricle Late Remodeling Following Myocardial Infarction in Rats. PLoS ONE 8(5): e64986. doi:10.1371/journal.pone.0064986 Left and Right Ventricle Late Remodeling Following Myocardial Infarction in Rats Ivanita Stefanon 0 Mara Valero-Mun oz 0 Aure lia Arau jo Fernandes 0 Roge rio Faustino Ribeiro Jr. 0 Cristina Rodrguez 0 Maria Miana 0 Jose Martnez-Gonza lez 0 Jessica S. Spalenza 0 Vicente Lahera 0 Paula F. Vassallo 0 Victoria Cachofeiro 0 Antonio Abbate, Virginia Commonwealth University, United States of America 0 1 Department of Physiological Sciences, Federal University of Espirito Santo , Vitoria, Espirito Santo , Brazil , 2 Department of Physiology, Universidad Complutense , Madrid , Spain , 3 Centro de Investigacio n Cardiovascular (CSIC-ICCC), Institut d'Investigaci o Biome`dica Sant Pau , Barcelona , Spain Background: The mechanisms involved in cardiac remodeling in left (LV) and right ventricles (RV) after myocardial infarction (MI) are still unclear. We assayed factors involved in collagen turnover in both ventricles following MI in rats either presenting signs of heart failure (pulmonary congestion and increased LVEDP) or not (INF-HF or INF, respectively). Methods: MI was induced in male rats by ligation of the left coronary artery. Four weeks after MI gene expression of collagen I, connective tissue growth factor (CTGF), transforming growth factor b (TGF-b) and lysyl oxidase (LOX), metalloproteinase-2 (MMP2) and tissue inhibitor metalloproteinase-2 (TIMP2) as well as cardiac hemodynamic in both ventricles were evaluated. Results: Ventricular dilatation, hypertrophy and an increase in interstitial fibrosis and myocyte size were observed in the RV and LV from INF-HF animals, whereas only LV dilatation and fibrosis in RV was present in INF. The LV fibrosis in INF-HF was associated with higher mRNA of collagen I, CTGF, TGF-b and LOX expressions than in INF and SHAM animals, while MMP2/ TIMP2 mRNA ratio did not change. RV fibrosis in INF and INF-HF groups was associated with an increase in LOX mRNA and a reduction in MMP2/TIMP2 ratio. CTGF mRNA was increased only in the INF-HF group. Conclusions: INF and INF-HF animals presented different patterns of remodeling in both ventricles. In the INF-HF group, fibrosis seems to be consequence of collagen production in LV, and by reductions in collagen degradation in RV of both INF and INF-HF animals. - Heart failure (HF) due to myocardial infarction (MI) is one of the major health care issues in the world and leads to a high rate of hospitalization and mortality. MI is accompanied by a woundrepairing process of the damaged area. This process involves a cascade of coordinated events resulting in both replacement of injured contractile tissue by a fibrotic scar and a remodeling in the remaining ventricle [13]. Even though it is well established that the development of HF depends on the size of the scar area [4], we have recently demonstrated that infarcted rats presenting scar areas between 30 50% of the left ventricle do not always develop typical signs of HF such as pulmonary congestion and increased left ventricle end diastolic pressure. In addition, both groups presented different pattern of vascular reactivity and remodeling process in the nonischemic myocardium [5,6]. Ventricular remodeling following MI involves complex biochemical, molecular and morphological alterations in both ischemic and remote non-infarcted myocardial area. This remodeling involves phenotypic changes in the myocytes as well as in the extracellular matrix, which results in myocardial fibrosis consequence of an imbalance between its production and degradation [7]. Collagen synthesis, preferentially mediated by myofibroblasts, is induced in response to different stimuli; these include mechanical stress, vasoactive factors such as angiotensin II and growth factors such as transforming growth factor b (TGF-b), which can act directly or through the up- regulation of connective tissue growth factor (CTGF) [810]. Collagen degradation is mediated by a family of zinc-containing endoproteinases matrix metalloproteinases (MMPs). These enzymes are found in the heart at low levels in normal conditions but can be up-regulated after MI in response to inflammatory cytokines and TGF-b. Their activity is modulated by endogenous inhibitors of MMP (TIMPs) which bind MMPs in a stoichiometric relation [11]. Another critical step in collagen fibre synthesis is the cross-linking of fibrillar collagen by the action of lysyl oxidase (LOX), an extracellular enzyme that confers the tensile strength and mechanical properties of collagen fibres [12,13]. Interestingly, collagen cross-links contribute to increased ventricular stiffness and reduced compliance; these could thus compromise ventricular function in cardiac diseases [14,15]. Growth factors such as TGF-b and CTGF and proinflammatory cytokines control LOX production in the heart and other tissues [13,16]. Although several factors involved in ventricular remodeling following MI have been identified, the late mechanism responsible for fibrosis in the non-ischemic myocardium of left and right ventricles that can trigger the development of functional alterations is not yet well understood. Moreover, whether these changes are associated with functional alteration in both ventricles is not well-established. Therefore, the aim of this study was to evaluate the different factors involved in the interstitial collagen turnover late after MI in animals presenting signs of HF or not, and whether these changes could account for the functional and morphological alterations in the non-ischemic myocardium of left and right ventricles in a rat model. Experimental Design and Animals Male Wistar rats (220240 g) were obtained from colonies maintained at Federal University of Espirito Santo. Rats were housed at constant room temperature (20 to 22uC), humidity (50 PRIMERS AND PROBES Sense 59 GGCTACCACATCCAAGGAAG 39 Antisense 59 CAATTACAGGGCCTCGAAAGA 39 Antisense 59 TGGTCTTGACTTCTATCTTGTTGAA 39 Probe 59 TEX-CGCAAATTACCCACTCCCGACCC-BBQ 39 Sense 59 CCCTGCAGCTGGAGAGTGT 39 Probe 59 6FAM-ACCCAAAGAAGAAGATGGAAAAGCGGTT-BBQ 39 Sense 59 TGGCCCTGACCCAACTATGAT39 Antisense 59 GCACTTTTTGCCCTTCTTAATGTT 39 Probe 59 6FAM-AGCCAACTGCCTGGTCCAGACCA-DB 39 Sense 59 GGGCTTTCGCTTCAGTGCT 39 Antisense 59 TCGGTTCATGTCATGGATGGT 39 Probe 59 6FAM-TCAGTCCCAAACGTCGAGGTGACCTG-DB 39 Sense 59 TGGTCCTCTGGGCATTGC 39 Collagen-1 Antisense 59 CACTGCCAGGGTTACCATCA 39 Probe 59 6FAM-TTCACCAGGGGCACCATTAACTCCA-DB 39 Sense 59CGTGGTGAGATCTTCTTCTTCAAGGA 39 Antisense 59 CCTCATACACAGCGTAATCTTTTC 39 Antisense 59 CCAGGGCACAATAAAGTCACAGA 39 Probe 59 6FAM-ACACCACGTGACAAGCCCACAGGTC-DB 39 Sense 59 GGAGGAAAGAAGGAATATCTAATTGCAG 39 Probe 59 6FAM-CATCTTGCCATCTCCTTCCGCCTTCC-DB 39 *TaqManTM Gene expression Assay (Applied Biosystems). doi:10.1371/journal.pone.0064986.t001 SHAM (n = 11) INF (n = 15) INF-HF (n = 8) LV+dP dt 21 (mmHg s21) 4,7596119 LV d (...truncated)