Mammary Cells with Active Wnt Signaling Resist ErbB2-Induced Tumorigenesis

Citation: Bu W, Zhang X, Dai H, Huang S, Li Y ( Mammary Cells with Active Wnt Signaling Resist ErbB2- Induced Tumorigenesis Wen Bu 0 Xiang Zhang 0 Hua Dai 0 Shixia Huang 0 Yi Li 0 Lu-Zhe Sun, University of Texas Health Science Center, United States of America 0 1 Lester & Sue Smith Breast Center, Baylor College of Medicine , Houston , Texas, United States of America, 2 Department of Molecular and Cellular Biology, Baylor College of Medicine , Houston , Texas, United States of America, 3 Department of Physiology, School of Medicine, Yangzhou University , Yangzhou, Jiangsu , China Aberrant activation of Wnt signaling is frequent in human malignancies. In normal epithelial tissues, including the breast, Wnt signaling is active only in a subset of cells, but it is unknown whether this subset of Wnt signaling-active cells is at increased risk of carcinogenesis. We created transgenic mice (TOP-tva) in which the synthetic Wnt-responsive promoter TOP controlled the gene encoding TVA, which confers susceptibility to infection by the retroviral vector RCAS. Thus, only cells in which Wnt signaling is active will express tva and be targeted by RCAS. Surprisingly, we found that RCAS-mediated delivery of cDNA encoding a constitutively activated version of ErbB2 (HER2/Neu) into the small number of TVA+ mammary epithelial cells in TOP-tva mice failed to induce tumor, while the same virus readily induced mammary tumors after it was delivered into a comparable number of cells in our previously reported mouse line MMTV-tva, whose tva is broadly expressed in mammary epithelium. Furthermore, we could not even detect any early lesions or infected cells in TOP-tva mice at the time of necropsy. Therefore, we conclude that the Wnt pathway-active cell subset in the normal mammary epithelium does not evolve into tumors following ErbB2 activation-rather, they apparently die due to apoptosis, an anticancer ''barrier'' that we have reported to be erected in some mammary cells followed ErbB2 activation. In accord with these mouse model data, we found that unlike the basal subtype, ErbB2+ human breast cancers rarely involve aberrant activation of Wnt signaling. This is the first report of a defined sub-population of mammalian cells that is ''protected'' from tumorigenesis by a potent oncogene, and provides direct in vivo evidence that mammary epithelial cells are not equal in their response to oncogene-initiated transformation. - Funding: This project was supported by BCM Pathology Core, which is funded in part by National Cancer Institute (NCI) P50-CA058183 and P30CA125123, and the Cytometry and Cell Sorting Core with funding from the National Institutes of Health (NIH) (http://nih.gov/) (National Institute of Allergy and Infectious Diseases P30AI036211, NCI P30CA125123, and National Center for Research Resources S10RR024574) and the assistance of Joel M. Sederstrom. This work was also supported in part by NIH R01 CA124820 (to YL), Congressionally Directed Medical Research Programs (http://cdmrp.army.mil/default.shtml) BC073703 and BC085050 (to YL), and U54CA149196 (to YL; PI: Stephan Wong). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. Members of the Wnt family are locally acting, extracellular matrix-binding glycoproteins that exert their biological effects by binding to their membrane receptors, the frizzled and lowdensity-lipoprotein receptor-related proteins (LRP5/6) [1]. As a result, b-catenin is stabilized, translocates to the nucleus, forms heterodimers with members of the TCF/LEF family of DNAbinding proteins, binds to the TCF binding motif in Wntresponsive genes, and transactivates them [2]. Wnt signaling is important in many developmental processes including embryogenesis, hair follicle regeneration, colorectal epithelium renewal, and mammary gland formation [1,3,4]. It is normally active in a subset of cells in a given tissue type. Mutational and epigenetic events activating Wnt signaling are frequent in many human malignancies [1]. For example, Wnt signaling activation is detected in a subset of human breast cancer, most notably the basal subtype [510], although mutations of genes encoding Wnt signaling components are rare in human breast tumors [11,12]. Numerous in vitro and in vivo experiments have demonstrated that aberrant activation of Wnt signaling causes or promotes cancer formation [2,13]. More recent studies show that Wnt signaling activation is important in generating and maintaining the cancer stem cell population within a cancer [1417]. Because Wnt signaling has a crucial role in carcinogenesis, the subset of cells with active Wnt signaling in a tissue may be at higher risk of cancer development than other cells with low or no Wnt signaling. This appears to be true in the intestine: intestinal cells that are positive for LGR5, a transcriptional target of Wnt signaling, are more easily induced to form cancer by ablation of APC than other cells in the same tissue [18]. Wnt signaling is active in a subset of cells in the mammary epithelium [1924]. In this report, we tested whether Wnt signaling-active mammary epithelial cells are more or less susceptible to tumor induction by aberrant ErbB2 signaling than other cells in the mammary epithelium. Materials and Methods Ethics Statement All procedures using mice were performed in compliance with a Baylor College of Medicine Animal Care and Use Committeeapproved animal protocol (protocol number: AN-2834). Transgenic Mice and Animal Care To create the TOP-tva transgenic construct, a PCR fragment from TOPdGFP [25] was first cloned into PCR2.1 vector using two primers, CAATTAACCCTCACTAAAGG and TCTTCGCTATTAC GCCAGTC. The DNA fragment containing the SV40 terminator and the TOP promoter containing 3 TCF binding sites and a c-Fos basic promoter were isolated from PCR2.1-TOP-d2GFP by Spe I and Xma I restriction enzymes, and then inserted in the MMTV-tva construct digested with Spe I and Xma I. From the resulting plasmid DNA, the vector DNA was removed by digestion with Bgl II. The remaining 2.1-kb DNA fragment contains the SV40 insulator, 3 TCF binding sites, c-Fos basic promoter, the tva cDNA, and the mouse protamine-1 poly (A) signal. This transgenic construct (TOP-tva) was injected into pronuclei from FVB/N mice. Potential founder mice were screened by PCR on tail DNA using oligos specific for the TOP-tva construct. MMTV-Wnt1 transgenic mice have been reported; the line used here was on the FVB background and was purchased from Charles Rivers. MMTV-tva mice have been previously reported [26]. All mice were kept on 2920X Teklad Global Extruded Rodent Diet (Soy Protein-Free) (Harlan Laboratories, Indianapolis, IN). Generation of Single Mammary Gland Suspension Cells and Flow Cytometry Generation of single mammary gland suspension cells has been reported previously [26] (...truncated)