Efficient Method of Genotyping Ob/Ob Mice Using High Resolution Melting Analysis

Chavin KD (2013) Efficient Method of Genotyping Ob/Ob Mice Using High Resolution Melting Analysis. PLoS ONE 8(11): e78840. doi:10.1371/journal.pone.0078840 Efficient Method of Genotyping Ob/Ob Mice Using High Resolution Melting Analysis Alton G. Sutter 0 Arun P. Palanisamy 0 Nichole Kurtz 0 Demetri D. Spyropoulos 0 Kenneth D. Chavin 0 Raghavan Raju, University of Alabama, Birmingham, United States of America 0 1 Division of Transplant Surgery/Department of Surgery, Medical University of South Carolina, Charleston, South Carolina, United States of America, 2 Department of Pathology and Laboratory Medicine, Medical University of South Carolina , Charleston, South Carolina , United States of America Objective: Direct health care costs of obesity continue to grow throughout the world and research on obesity disease models are on the rise. The ob/ob mouse is a well-characterized model of obesity and associated risk factors. Successful breeding and backcrossing onto different backgrounds are essential to create knockout models. Ob/ob mice are sterile and heterozygotes must be identified by genotyping to maintain breeding colonies. Several methods are employed to detect the ob mutant allele, a single nucleotide polymorphism (SNP). Gel based methods are time consuming and inconsistent, and non-gel based assays rely upon expensive and complex reagents or instruments. A fast, high-throughput, cost effective, and consistent method to identify Lepob mutation is much needed. Design and Methods: Primers to produce an amplicon for High Resolution Melting Analysis (HRM) of the Lepob SNP were designed and validated. Results: Fluorescence normalized high resolution melting curve plots delineated ob/+, ob/ob, and WT genotypes. Genotypes were also confirmed phenotypically. Conclusions: HRM of the Lepob SNP allows closed-tube identification of the Lepob mutation using a real-time PCR machine now common to most labs/departments. Advantages of this method include assay sensitivity/accuracy, low cost dyes, less optimization, and cost effectiveness as compared to other genotyping techniques. - . These authors contributed equally to this work. As the global burden of obesity doubled between 1980 and 2008, the importance of basic science research on the disease grows [1]. Multiple animal models exist for the investigation of obesity. These include diet induced obesity and multi- and polygenic rodent models. One of the best-characterized and widely used models is the ob/ob mouse, which does not produce functional leptin, yielding hyperphagy, lethargy, and morbid obesity. Ob/ob mice are widely used to study diabetes, fatty liver disease, and leptin signaling. Multiple animal models utilizing the allele have been generated through backcrossing onto different genetic backgrounds (4), and crossing with other mutant strains to create multiple knockout models [2,3]. Unfortunately, ob/ob mice are sterile and breeding of complete knockouts is impractical as male ob/ob mice must be maintained on a calorie restricted diet, and females supplemented with leptin from an early postnatal age through gestation and nursing [4]. Thus, fertile heterozygotes are identified by genotyping methods to maintain efficient breeding colonies for the production of wild type, heterozygous, and homozygous test animals. Furthermore, heterozygous animals are grossly indistinguishable from wild type, yet deviate in other important phenotypic characteristics (e.g., adiposity, fasting blood glucose, and metabolic efficiency) from homozygous wild type animals. Thus their identification is not only important for breeding purposes, but also to avoid their use in lean control groups [5,6]. The Lepob mutation is a single nucleotide polymorphism (SNP) and its detection relies on either gel-based methods that are time consuming and inconsistent or non-gel based assays that rely upon expensive and complex reagents or instrumentation. Restriction fragment length polymorphism (RFLP) analysis methods for the identification of ob/+ heterozygotes were designed by Chung et al, Hirasawa et al, and Namae et al [7,8,9]. RFLP analysis is a gelbased method requiring extensive post-PCR processing and the use of restriction enzymes. Other methods such as pyrosequencing or end-point analysis require the use of costly instrumentation or fluorescently labeled probes [10,11]. Further methods using nucleotide invasion assays have been developed which are less labor intensive but require the use of costly probes [10,12]. Our group previously reported a PCR- based method for ob genotyping [13]. However, this method requires two sets of PCR reactions and gels for each analysis, which is cumbersome and time consuming for the management of large colonies. TCTTGGAGAAGGCCAGCAGAT High Resolution Melting Analysis (HRM) of the ob SNP, described here, aids in fast, high-throughput, and closed-tube identification of the Lepob mutation without sacrificing assay sensitivity or accuracy. HRM uses low cost dyes, requires less optimization, is more cost effective than other genotyping techniques due to decreased reagent and personnel costs, and utilizes common RT-PCR instrumentation. HRM analysis has been used to rapidly identify disease causing point mutations and antibiotic resistant bacteria [12,14,15,16]. The first step of the HRM analysis is amplification of the region of interest using standard PCR techniques. The PCR product is then melted in the presence of a specialized doublestranded DNA intercalating dye with fluorescence intensity thereby being acquired throughout. The dye is highly fluorescent when bound to dsDNA and poorly fluorescent in the unbound state after dissociation, or melting, of the DNA duplex. The change in fluorescence, as the DNA is denatured by increasing temperature, is monitored to produce a characteristic melting profile that is sensitive enough to allow the detection of a single base change between otherwise identical nucleotide sequences. HRM analysis is able to discriminate the melting transitions of heteroduplexes by utilizing dyes which are not released at lower temperatures to redistribute and bind to higher melting temperature homoduplexes [13]. It is this discrimination of heteroduplex melting curves that allows the identification of heterozygous animals. Ethics Statement Tail clippings from WT, ob/+, and ob/ob mutant mice were collected and utilized for this study because of the nature of information sought. All rodents used for tail clipping were anesthetized using isoflurane. Tails were cauterized after clipping. Animals were observed post-clipping for signs of distress such as discernable pain. Buprenorphine was given as an analgesic drug to reduce pain and discomfort. Animals are removed from the study and euthanized by exsanguination (under anesthesia) or CO2 when suffering negates the need to continue humanely in accordance with the Medical University of South Carolinas Institutional Animal Care and Use Committee (...truncated)