Peripheral Nervous System Neuropathology and Progressive Sensory Impairments in a Mouse Model of Mucopolysaccharidosis IIIB

McCarty DM (2012) Peripheral Nervous System Neuropathology and Progressive Sensory Impairments in a Mouse Model of Mucopolysaccharidosis IIIB. PLoS ONE 7(9): e45992. doi:10.1371/journal.pone.0045992 Peripheral Nervous System Neuropathology and Progressive Sensory Impairments in a Mouse Model of Mucopolysaccharidosis IIIB Haiyan Fu 0 Julianne D. Bartz 0 Robert L. Stephens 0 Jr. 0 Douglas M. McCarty 0 Thomas H. Gillingwater, University of Edinburgh, United Kingdom 0 1 Center for Gene Therapy, The Research Institute at Nationwide Children's Hospital , Columbus , Ohio, United States of America, 2 Department of Pediatrics, The Ohio State University , Columbus , Ohio, United States of America, 3 Department of Physiology and Cell Biology, The Ohio State University , Columbus, Ohio , United States of America The lysosomal storage pathology in Mucopolysaccharidosis (MPS) IIIB manifests in cells of virtually all organs. However, it is the profound role of the neurological pathology that leads to morbidity and mortality in this disease, and has been the major challenge to developing therapies. To date, MPS IIIB neuropathologic and therapeutic studies have focused predominantly on changes in the central nervous system (CNS), especially in the brain, and little is known about the disease pathology in the peripheral nervous system (PNS). This study demonstrates characteristic lysosomal storage pathology in dorsal root ganglia affecting neurons, satellite cells (glia) and Schwann cells. Lysosomal storage lesions were also observed in the myoenteric plexus and submucosal plexus, involving enteric neurons with enteric glial activation. Further, MPS IIIB mice developed progressive impairments in sensory functions, with significantly reduced response to pain stimulation that became detectable at 4-5 months of age as the disease progressed. These data demonstrate that MPS IIIB neuropathology manifests not only in the entire CNS but also the PNS, likely affecting both afferent and efferent neural signal transduction. This study also suggests that therapeutic development for MPS IIIB may benefit from targeting the entire nervous system. - Mucopolysaccharidosis (MPS) IIIB is a lysosomal storage disease caused by the autosomal recessive defect of a-Nacetylglucosaminidase (NaGlu) gene [1]. NAGLU is a lysosomal enzyme that is essential in the stepwise metabolic degradation of heparan sulfate (HS), a class of biologically important glycosaminoglycans (GAGs). Mutations are highly heterogenic among patients with MPS IIIB [1,2,3]. The lack of NaGlu activity results in the accumulation of HS and HS-derived oligosaccharides in lysosomes of cells in virtually all organs, especially cells throughout the central nervous system (CNS), including neuronal and nonneuronal cell-types, although not all CNS cells are affected [4]. Patients with MPS IIIB appear normal at birth, but develop a progressive and severe neurological disorder, though somatic manifestations of MPS IIIB are relatively mild compared to other types of MPS. High mortality and premature death are typical in MPS IIIB patients. Only Palliative treatment is available for the disease. It is known that the lysosomal storage pathology of MPS IIIB is global throughout the CNS and neuropathology studies have focused predominantly on changes in the brain, though previous studies showed lysosomal storage lesions in all parts of the CNS in mice and dogs [4,5]. Further, it is commonly accepted that in the brain, multiple factors contribute to the neuropathology, secondary to the primary pathology- the lysosomal storage of HS-GAGs [4,6,7,8,9,10,11,12,13,14]. The complex MPS IIIB neuropathology has been shown to involve impaired metabolism, inflammation, neurodegeneration, reactive oxygen species and tauopathy. A correlation between high efficiency of GAG synthesis and a severe phenotype was recently reported in patients with MPS, including MPS II, IIIA and IIIB [15]. However, little is known regarding the lower CNS and PNS neuropathology. A recent study revealed thinning of the outer nuclear layer and inclusions in pigmented epithelium of the retina, and loss of hair cells in the inner ear and histologic abnormalities in the middle ear, and showed impaired vision and hearing in MPS IIIB mice [16]. In MPS IIIB gene therapy studies, an intracisternal and/or a systemic delivery of adeno-associated viral vector following mannitol pretreatment to disrupt the blood-brain-barrier yielded improvements in longevity and cognitive function [17,18,19,20]. However, significantly improved motor function in the rotarod assay was observed only when the systemic vector delivery was also involved, suggesting that deficiencies in motor function can only be effectively corrected with gene delivery to both the CNS and the periphery. This may be supported by a recent study showing that combining intracranial AAV vector delivery and syngeneic bone marrow transplant resulted in improved therapeutic impact in MPS IIIB mice, compared to each approach only [21]. The present study demonstrates that the MPS IIIB neuropathology is present throughout the entire nervous system, including the CNS and PNS. We demonstrate characteristic lysosomal storage in the dorsal root ganglion (DRG) and enteric nervous system (ENS) in an MPS IIIB mouse model. Our data also showed significant impairment in pain sensory capacity as the disease progresses. These data suggest the potential role of the PNS neuropathy in MPS IIIB. Materials and Methods MPS IIIB Mice The mouse model of MPS IIIB, generated by homologous recombination [4], was maintained on an inbred background (C57BL/6) of backcrosses of heterozygotes. The MPS IIIB mice resemble the human disease, have no detectable NaGlu activity in any tissue, and exhibit characteristic lysosomal storage pathology and clinical disorders. The mice were housed in the Vivarium at the Research Institute at Nationwide Childrens (NCRI). All care and procedures were in accordance with the Guide for the Care and Use of Laboratory Animals [DHHS Publication No. (NIH) 85-23. The genotypes of progeny mice were identified by PCR, using primers targeting undisrupted mouse NaGlu Exon 6: 59TGGACCTGTTTGCTGAAAGC (sense) and 59-CAGGCCATCAAATCTGGTAC (anti-sense), and the transgene (neomycin): 59-TGGGATCGGCCATTGAACAA (sense) and 59CCTTGAGCCTGGCGAACAGT (anti-sense). MPS IIIB mice and their wild type (wt) littermates were used in this study. The animal studies have been approved by the IACUC committee in the Research Institute at Nationwide Childrens Hospital (IACUC#: 04804AR). Histopathology and Transmission Electron Microscopy (TEM) For tissue sample collection, age-matched MPS IIIB and wt mice (n = 4 each) were anesthetized with an intraperitoneal injection of avertin (2.5%, 0.30.4 mg/g body weight), and were then perfused transcardially with cold PBS (0.1 M, pH 7.4) followed by 4% paraformaldehyde in phosphate buffer (0.1 M, pH 7.4). Spinal cord and small inte (...truncated)