Development of the Fc-III Tagged Protein Expression System for Protein Purification and Detection

Deng H (2012) Development of the Fc-III Tagged Protein Expression System for Protein Purification and Detection. PLoS ONE 7(8): e44208. doi:10.1371/journal.pone.0044208 Development of the Fc-III Tagged Protein Expression System for Protein Purification and Detection Shan Feng 0 1 Enbing Tian 0 1 Lei Zhang 0 1 Qingtao Wang 0 1 Haiteng Deng 0 1 Maria Gasset, Consejo Superior de Investigaciones Cientificas, Spain 0 Funding: This work was supported in part by the Center for Life Sciences (Tsinghua University), the National Natural Science Foundation of China (No.30872391), and U.S. National Institutes of Health grants (U19 DE018385). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript 1 1 School of Life Sciences, Tsinghua University , Beijing , China , 2 Beijing Chaoyang Hospital affiliated Capital Medical University , Beijing , China In the present work, we developed the Fc-III tagged protein expression system for protein purification and detection. The Fc-III sequence encodes for a 13 residue peptide and this peptide is cyclized by disulfide bond formation when the fusion protein is expressed. The Fc-III-fusion proteins selectively bind to immunoglobulin Fc domains (IgG-Fc) expressed from E. coli. We showed the efficient purification of Fc-III tagged proteins by immobilized non-native IgG-Fc and the detection of the cellular locations of fusion proteins by fluorescent-conjugated IgG-Fc. Our results prove that Fc-III tagged protein expression system is a simple and efficient tool for protein purification and detection and is a useful addition to the biochemistry and proteomics toolbox. - Protein tagging involves genetically grafting a peptide sequence onto a recombinant protein. These fusion proteins have various applications in molecular biology such as affinity purification, protein detection, and epitope presentation [13]. Affinity tags that are appended to proteins are used to purify targeted proteins from their crude biological sources using affinity techniques. These include chitin binding protein (CBP), maltose binding protein (MBP), and glutathione-S-transferase (GST). The poly(His) tag is one of the most widely-used protein tag for protein purification with metal matrices [45]. Despite the broad applications of the existing affinity tags, it is difficult to decide on the best fusion system for a target protein of interest due to the diverse chemical natures of the target protein such as their stability, hydrophobicity, solubility and pI. Development of the new protein tags is important to provide a variety of tools for protein purification and detection. In the present study, we engineered an Fc-III tagged fusion protein expression system. The Fc-III peptide is a mimic of Protein A, a commonly used affinity tag. The genetically expressed Protein A (PrA) fusion proteins from Staphylococcus aureus has a high affinity (10 nM) to the constant region (Fc) of immunoglobulin G (IgG) [6]. The large size of PrA may have adverse effects on the native conformation of the targeted protein and the binding to other proteins. Using phage display, several peptides have been identified to have high affinity to IgG-Fc [78]. One of the PrA like-peptides was named Fc-III [7]. The sequence of Fc-III peptide is DCAWHLGELVWCT-NH2, in which two Cys residues form a disulfide bond to make the cyclized peptide. The synthetic Fc-III peptide binds to the surface of the IgG-Fc domain by mimicking the protein-protein binding interface of PrA for the hinge region on the IgG-Fc. The affinity with a Kd value of 185 nM for the binding of the Fc-III peptide to IgG-Fc depends on both the CysCys disulfide bridge and the C-terminal amide group [8]. An elegant application of Fc-III peptides was developed by Strambiode-Castillia et al. to competitively displace affinity-purified Protein A fusion proteins and protein complexes from IgG-Sepharose with biotinylated Fc-III [9]. The other potential applications of synthetic Fc-III or Fc-III like peptides were to detect or purify human IgG molecules [1011]. Materials and Methods Plasmid Construction The gene of CA (carbonic anhydrase) was a gift from Zhou HMs laboratory at Tsinghua University and was cloned into the expression vector pET28a (Novagen). The primers of the inserting Fc-III peptide were the followings: (1) N-terminal insertion (F5: GACTGTGCATGGCATCTTGGAGAACTCGTATGGTG TACTGGAATGTCCCATCACTGGGG; r3: CATGGTATATCTCCTTCTTAAAGTTAAAC), and (2) C-terminal insertion (F5: GACTGTGCATGGCATCTTGGAGAACTCGTATGGTGTACTGAGCACTGAGATCCGGCTGC; r3: GAGTTTGAAGGAAGCTTTGATTTGCCTG). The codons of the Fc-III peptide are underlined. The gene of CK (creatine kinase) was bought from Addgene, and was cloned into pET21a (Novagen). Various primers were used to construct HisTag fused CK, N-terminal Fc-III tagged CK and C-terminal Fc-III tagged CK. The gene of CD38 was cloned from the mRNA by RT-PCR from the Raji cell line (purchased from ATCC), which was then sub-cloned into eukaryotic plasmid pcDNA3.1B (Invitrogen). The Fc-III peptide was added onto the N-terminus of CD38, and the primers are the followings: F5: ATGGACTGTGCATGGCATCTTGGAFigure 1. Comparison of reduced and non-reduced peptides containing Fc-III in MS spectra. (A) The MS spectrum of the tryptic peptide containing Fc-III peptide from trypsin digestion of the N-terminal Fc-III fused CA. The mono-isotope peak at m/z 701.30 matched to the quadruply charged peptide MDCAWHLGELVWCTGMSHHWGYGK. (B) The MS spectrum of the tryptic peptide containing carboxymethylated Fc-III peptide from trypsin digestion of the reduced and alkylated Fc-III-tagged CA The mono-isotope peak at m/z 730.32 matched to the quadruply charged peptide MDCAWHLGELVWCTGMSHHWGYGK with two carboxymethylated cysteines, (C) The MS/MS spectrum of quadruply charged peptide ion MH44+ at m/z 730.32. The labeled peaks correspond to masses of y ions and b ions of the selected peptide. doi:10.1371/journal.pone.0044208.g001 GAACTCGTATGGTGTACTGCCAACTGCGAGTTCAGCC; and r3: AAGCTTAACTAGCCAGC. Protein Expression and Purification CA-II, Fc-III tagged CA-II, IgG-Fc and different CK proteins were expressed in E. Coli BL21(ED3)-pLysS strain (Stratagene, Heidelberg, Germany) and purified. Briefly, for Fc-III tagged CA and CK, the cell lysates were incubated with IgG-beads (GE Healthcare) or immobilized IgG-Fc sepharose beads for 1 hour at 4uC, and were eluted with HAc-NH4Ac (pH3.4); for other Histagged proteins, Ni-FF (Qiagen) columns were used, and proteins were eluted with 250 mM imidazole in PBS (pH8.0). For biochemical analysis, the samples were dialyzed and loaded onto Sephacryl S300 column. The purity of the recombinant protein was characterized by SDS-PAGE. All the protein concentrations were determined using Bradford method with BSA as the standard. LC-MS/MS Analysis and Data Processing Protein bands of interest were excised from the SDS PAGE and digested by trypsin with or without pri (...truncated)