Effects of Dietary Supplementation with Glutamate and Aspartate on Diquat-Induced Oxidative Stress in Piglets

April Effects of Dietary Supplementation with Glutamate and Aspartate on Diquat-Induced Oxidative Stress in Piglets Jie Yin 1 2 Mingfeng Liu 1 2 Wenkai Ren 1 2 Jielin Duan 1 2 Guan Yang 1 2 Yurong Zhao 1 2 Rejun Fang 1 2 Lixiang Chen 1 2 Tiejun Li 1 2 Yulong Yin 1 2 0 211 Huiming Road, Wenjiang district, Chengdu , China 1 1 Scientific Observing and Experimental Station of Animal Nutrition and Feed Science in South-Central, Ministry of Agriculture, Hunan Provincial Engineering Research Center of Healthy Livestock, Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences , Changsha, Hunan, 410125, China , 2 University of Chinese Academy of Sciences , Beijing, 100039, China , 3 Department of Animal Science, University of Hunan agriculture , Changsha, 410128, China , 4 Department of Animal Science, University of Florida , Gainesville, Florida, 32610 , United States of America, 5 Southwest Collaborative Innovation Center of Swine for Quality & Safety , 211 2 Academic Editor: Lynette K. Rogers , The Ohio State Unversity, UNITED STATES This study aimed to investigate the protective effects of dietary glutamate and aspartate supplementations on diquat-induced oxidative stress in piglets. Diquat injection significantly reduced growth performance, including body weight, average daily weight gain, and feed intake (P<0.05). Meanwhile, diquat administration induced oxidative stress evidenced by the decreased serum nitric oxide (NO) and elevated malondialdeyhde (MDA) concentration (P<0.05). Furthermore, diquat-induced oxidative stress disrupted intestinal absorption system and decreased serum threonine, serine, and glycine levels. Dietary supplementation with glutamate improved final body weight, antioxidant system, and expressions of amino acids transporters and enhanced serum glutamate concentration compared with diquat group (P<0.05). While aspartate failed to alleviate diquat-induced oxidative stress, growth depression, and dysfunction of nutrients absorption except for liver relative weight. In conclusion, dietary supplementation with glutamate confers beneficial effects on diquat-induced oxidative stress in piglets, while aspartate exhibits little effects. - Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: The present work was supported by grants from the National Natural Science Foundation of China (Nos. 31330075, 31110103909, 31101729, 31402088, 31201813, and 31272463) and the Hunan Provincial Natural Science Foundation of China (Nos. 12JJ2014, 2013RS4065, and 12JJ2020). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Oxidative stress can be induced by various factors during the animal growth and development, including physical (weaning, housing, transport, and novel handling), social (relocation with unfamiliar penmates), and pathological environments [13]. We found that pathological factors such as mold-contaminated feed, porcine circovirus type 2 infection, and dextran sulfate sodium-induced colitis exhibit an inhibitory effect on activities of antioxidant enzymes and induce oxidative stress in pigs and mice [35]. Our latest studies also revealed that birth and Competing Interests: The authors have declared that no competing interests exist. weaning processes disrupt oxidative balance and cause oxidative injury in piglets [2,6]. Oxidative stress correlates with the modification of protein, lipid oxidation, and nucleic acid breaks, and compelling evidences have demonstrated that oxidative stress involves in the development of many diseases [1]. Glutamate and aspartate are functional amino acids and have been shown to exert various functions in nutrients metabolisms, energy requirements, immune responses, oxidative stress, regulation of signaling pathways, and synaptic transmitting [79]. Dietary supplementation with glutamate exhibits a beneficial role in deoxynivalenol and mycotoxins challenged pigs [10,11]. Furthermore, Pi et al. reported that dietary supplementation of aspartate enhances intestinal integrity and energy status in weanling piglets after lipopolysaccharide challenge [12]. However, little is known about effects of glutamate and aspartate on oxidative stress. Diquat has been widely used to induce oxidative stress in vivo and injection of diquat exerts inhibitory effects on growth performance [13] and nutrients metabolism [14]. Thus, the current study was to investigate the protective roles of dietary glutamate and aspartate in diquat-induced oxidative stress in piglets. Materials and Methods This study was conducted according to the guidelines of the Declaration of Helsinki and all procedures involving animal subjects were approved by the animal welfare committee of the Institute of Subtropical Agriculture, University of Chinese Academy of Sciences [13]. Twenty-four healthy piglets of similar body weight (9.92 0.30 kg) (Landrace Large White) (ZhengHong Co., China) were randomly divided into four groups (n = 6): one control group (control), one diquat group (diquat), one glutamate group in which piglets were fed 2% glutamate (glutamate group), and one aspartate group in which piglets received 2% aspartate (aspartate group). All piglets were fed basal diet for 5 days, then injected intraperitoneally (i.p.) with either 10 mL saline or 10 mg/kg body weight diquat in 10 ml saline to induce oxidative stress according to previous report [14]. After injection of diquat, feed in glutamate and aspartate groups was added 2% glutamate and 2% aspartate, respectively. Feed intake was recorded daily to calculate average daily feed intake (ADFI). After 7 days of experimental period, body weight was weighed and blood was sampled from a jugular vein before slaughter [15]. All piglets were anesthetized with sodium pentobarbital and killed by jugular puncture [16]. The basal diet was prepared from corn, soybean meal, wheat bran, limestone, CaHPO4, NaCl, and additive premix to meet or exceed the nutritional requirements of piglets according to our previous report [17]. Glutamate and aspartate were added to the feed and mixed uniformly. Calculation of relative organ weights The heart, liver, spleen, and kidney were separated and weighed. The relative organ weights were calculated basing the ratio of organ weigh to body weight [18]. Measurements of oxidative stress index Blood samples were centrifuged at 3000 g for 10 min and 4C, and supernatant were collected for serum analysis [19]. Superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), nitric oxide (NO), and malondialdeyhde (MDA) in serum were measured using spectrophotometric kits in accordance with the manufacturers instructions (Nanjing Jiangcheng Biotechnology Institute, China) [20]. Primer squence (5-3) F:GGCACCGCACTCTACGAAGCA R:GCCCACGGCACTTAGCACGA F: TGCCCATACTTCCCGTCC R:GGTCCAGGTTACCGT (...truncated)