Correction: Correction: Increase in Resistance to Extended-Spectrum Cephalosporins in Salmonella Isolated from Retail Chicken Products in Japan

CORRECTION Correction: Correction: Increase in Resistance to Extended-Spectrum Cephalosporins in Salmonella Isolated from Retail Chicken Products in Japan The PLOS ONE Staff There is an error in Table 1 of the correction. The publisher apologizes for the error. Please see the corrected Table 1 here. In Table 2, cells including “Thi0073” in the Reference column should read “This study.” Please see the corrected Table 2 here. OPEN ACCESS Citation: The PLOS ONE Staff (2015) Correction: Correction: Increase in Resistance to ExtendedSpectrum Cephalosporins in Salmonella Isolated from Retail Chicken Products in Japan. PLoS ONE 10(7): e0133094. doi:10.1371/journal.pone.0133094 Published: July 16, 2015 Copyright: © 2015 The PLOS ONE Staff. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. PLOS ONE | DOI:10.1371/journal.pone.0133094 July 16, 2015 1/4 PLOS ONE | DOI:10.1371/journal.pone.0133094 July 16, 2015 2/4 susceptibility antimicrobial isolates with Untested of isolate) Infantis (5), Typhimurium - (2), with O4:i:- (1) - (1) with O7:y:- Untypeable (1), Yovokome (12), Infantis 0 14 (42.4%) 14 33 2002 - (3) Untypeable (2), - (1) Untypeable (1), Yovokome (1), Manhattan Manhattan (14), Infantis (9), (1), Enteritidis 0 13 (37.1%) 13 35 2004 Infantis Haifa (1), Cerro (1), 0 21 (53.8%) 21 39 2003 Montevideo (1), Manhattan (2), Infantis (15), Corvallis (1), Haifa (1), Enteritidis (1), 3 25 (55.0%) 22 40 2005 - z24 (1) - Unrecorded (5), Typhimurium (6), Haifa (6), Enteritidis (6), Corvallis (8), Untypeable (11), Manhattan (52), (70), Schwarzengrund Infantis (180), 22 378 (45.6%) 355 779 Total - (Continued) 5 serotypes (34)‡ - Untypeable (1) O4 (1), Untypeable with Virchow (1), (18), Schwarzengrund Manhattan (19), Infantis (20), Agona (1), 6 61 (51.9%) 55 106 2010 and other - Untypeable (3) O4 (3), Untypeable with (21), Schwarzengrund Manhattan (8), Infantis (14), Enteritidis (1), 2 50 (54.5%) 48 88 2009 O7 (1) Unrecorded (5) Unrecorded (5) r:1,5 (3), O-untypeable: Untypeable with (21), Schwarzengrund Manhattan (15), Jamaica (1), Infantis (33), Eppendorf (2), Enteritidis (1), 4† 81 (48.4%) 76 157 2008 Untypeable with O4 (1), Untypeable with Untypeable (2) (7), Schwarzengrund Manhattan (2), Infantis (8), Eppendorf (1), Enteritidis (1), Emek (1), Corvallis (1), 2 24 (55.0%) 22 40 2007 Typhimurium (1), - (2) Schwarzengrund Manhattan (3), Infantis (8), Dunkwa (1), 1 14 (32.5%) 13 40 2006 Typhimurium (1), (1), - with O7 (1) Untypeable z4,z23:- (3), with O18: Untypeable Virchow (2), Infantis (8), Haifa (2), 0 16 (44.4%) 16 36 2001 Schwarzengrund - with O7 (1) - Untypeable Untypeable (18), Infantis (1), Corvallis 0 20 (57.1%) 20 35 2000 (1) with O7 (1), Untypeable Infantis (3), 1 5 (11.8%) 4 34 1999 with O8:z4, - (1) Typhimurium Infantis (1), (1), Enteritidis Corvallis (3), 0 6 (17.6%) 6 34 1998 Untypeable (1), with O4:b:- Untypeable Typhimurium Untypeable (1), Haifa (1), Corvallis (1), Agona (1), 3 12 (42.9%) 9 21 1997 Infantis (12), Haifa (1), *, isolated, (No. Corvallis (1) serotypes 0 Salmonella were isolated serotypes Salmonella multiple which samples from No. of isolates Salmonella (39.0%) 16 No. of 16 41 1996 (%) samples positive Salmonella- No. of tested samples No. of year Isolation Table 1. Number of tested chicken meat product samples, detected Salmonella isolates, resistant isolates, and resistance genes by year. PLOS ONE | DOI:10.1371/journal.pone.0133094 July 16, 2015 3/4 - (0.0%) 0 (16) 16 1996 - (0.0%) 0 (9) 12 1997 - (0.0%) 0 (6) 6 1998 - (0.0%) 0 (4) 5 1999 - (0.0%) 0 (20) 20 2000 - (0.0%) 0 (16) 16 2001 - (0.0%) 0 (14) 14 2002 - (0.0%) 0 (21) 21 2003 - (0.0%) 0 (13) 13 2004 n = 1)§, CMY-2 (Infantis, (8.0%) 2 (22) 25 2005 n = 1) CMY-2 (Infantis, (4.2%) 1 (22) 24 2007 n = 1) untypeable:r:1,5, n = 1), (Manhattan, n = 1) TEM-52 (Infantis, n = 1), TEM-20 (Infantis, n = 1), (Manhattan, SHV-12 n = 1), (Manhattan, CTX-M-2 (Infantis, n = 1), (Manhattan, n = 1) CTX-M-2 SHV-12 n = 2), CMY-2 (OTEM-1 n = 1), (Manhattan, CMY-2 CTX-M-15 & (Infantis, n = 1) (Manhattan, n = 2), CTX-M-2 CTX-M-2 (Manhattan, n = 1), TEM-52 (Manhattan, n = 2), (Manhattan, TEM-1 n = 1), n = 1), CTX-M-15 & n = 24), CMY-2 (Infantis, (9.4%) 35 (350) 373 Total TEM-52 n = 1) n = 1), (Manhattan, CMY-2 n = 11), CMY-2 (Infantis, (27.9%) 17 (55) 61 2010 TEM-52 (Infantis, (Manhattan, TEM-52 n = 6), CMY-2 (Infantis, (14.0%) 7 (48) 50 2009 untypeable:r:1,5, CMY-2 (O- n = 5), CMY-2 (Infantis, (10.5%) 8 (71) 76 2008 Other serotypes, untypeable with O4 (5), untypeable with O7 (4), Eppendorf (3), untypeable with O18:z4,z23:- (3), untypeable with O-untypeable:r:1,5 (3), Virchow (3), Agona (2), n = 1) TEM-20 (Infantis, - (0.0%) 0 (13) 14 2006 CMY-2, blaCMY-2. doi:10.1371/journal.pone.0133094.t001 § Yovokome (2), Cerro (1), Dunkwa (1), Emek (1), Jamaica (1), Montevideo (1), untypeable with O4:b:- (1), untypeable with O4:i:- (1), untypeable with O7:y:- (1), and untypeable with O8: z4,z24 (1). ‡ *Corvallis, Salmonella enterica subsp. enterica serovar Corvallis. † One sample contained three serotypes, while other multi-Salmonella samples contained two serotypes. serotypes genes and resistance Detected isolates) of tested (Percentage isolates resistant No. of samples) (No. of isolates No. of tested year Isolation Table 1. (Continued) Table 2. Sequences of primers used in this study. bla gene Purpose blaCMY Detection Sequencing blaCTX-M Detection and Sequencing Sequencing blaTEM Detection Sequencing blaSHV Detection Sequencing Primer Name Nucleotide Sequence 50 –30 Reference cmy-F GACAGCCTCTTTCTCCACA [22] cmy-R TGGAACGAAGGCTACGTA [22] This study CMY2-outF GTTACAATGTGTGAGAAGCAGTC CMY2-outR ATGGGATTTTCCTTGCTGTA This study CMY2-R0 CAGTATTTCGTGACCGGA This study CMY2-F3 CTGGATTACGGTTCCGCA This study CTX-MU1 ATGTGCAGYACCAGTAARGT [23] CTX-MU2 TGGGTRAARTARGTSACCAGA [23] blaCTX-M-1, forward CTTCCAGAATAAGGAATCCC [26] blaCTX-M-1, reverse CGTCTAAGGCGATAAACAAA [26] CTX-outF2 GCCAAGGGATAATACTAATAGAGG This study CTX-outR GCGGAATGATAGAAAGAGATGAG This study CTX-F2 ACAATACTGCCATGAATAAGCTG This study CTX-R0 CAATCAGCTTATTCATGGCA This study MAb/F GGGGAGCTCATAAAATTCTTGAAGAC [24] MAb/R GGGGGATCCTTACCAATGCTTAATCA [24] MAb-F2 AGCCCTCCCGTATCGTAGTT This study MAb-F1 GAGGACCGAAGGAGCTAACC This study MAb-outR AACTACGATACGGGAGGGCT This study SHV-F AGGATTGACTGCC (...truncated)