Normal Platelet Integrin Function in Mice Lacking Hydrogen Peroxide-Induced Clone-5 (Hic-5)

RESEARCH ARTICLE Normal Platelet Integrin Function in Mice Lacking Hydrogen Peroxide-Induced Clone-5 (Hic-5) Michael Popp, Ina Thielmann, Bernhard Nieswandt, David Stegner* Department of Experimental Biomedicine–Vascular Medicine, University Hospital and Rudolf Virchow Center, University of Würzburg, Würzburg, Germany * Abstract OPEN ACCESS Citation: Popp M, Thielmann I, Nieswandt B, Stegner D (2015) Normal Platelet Integrin Function in Mice Lacking Hydrogen Peroxide-Induced Clone-5 (Hic-5). PLoS ONE 10(7): e0133429. doi:10.1371/journal. pone.0133429 Editor: Toshiyuki Miyata, National Cerebral and Cardiovascular Center, JAPAN Received: April 14, 2015 Integrin αIIbβ3 plays a central role in the adhesion and aggregation of platelets and thus is essential for hemostasis and thrombosis. Integrin activation requires the transmission of a signal from the small cytoplasmic tails of the α or β subunit to the large extracellular domains resulting in conformational changes of the extracellular domains to enable ligand binding. Hydrogen peroxide-inducible clone-5 (Hic-5), a member of the paxillin family, serves as a focal adhesion adaptor protein associated with αIIbβ3 at its cytoplasmic tails. Previous studies suggested Hic-5 as a novel regulator of integrin αIIbβ3 activation and platelet aggregation in mice. To assess this in more detail, we generated Hic-5-null mice and analyzed activation and aggregation of their platelets in vitro and in vivo. Surprisingly, lack of Hic-5 had no detectable effect on platelet integrin activation and function in vitro and in vivo under all tested conditions. These results indicate that Hic-5 is dispensable for integrin αIIbβ3 activation and consequently for arterial thrombosis and hemostasis in mice. Accepted: June 26, 2015 Published: July 14, 2015 Copyright: © 2015 Popp et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This work was supported by the Rudolf Virchow Center and the Deutsche Forschungsgemeinschaft (SFB688). This publication was funded by the German Research Foundation (DFG) and the University of Wuerzburg in the funding programme Open Access Publishing. Competing Interests: The authors have declared that no competing interests exist. Introduction Vessel wall injury results in the exposure of the subendothelial extracellular matrix which initiates stable platelet adhesion and aggregation [1,2]. These processes are crucial for normal hemostasis, but in diseased vessels they may lead to pathological thrombus formation and infarction of vital organs [3]. Platelet adhesion and aggregation are mediated by integrins, heterodimeric transmembrane receptors composed of α and β subunits that are expressed in a low affinity state under resting conditions. The major platelet integrin αIIbβ3 is present in high copy numbers (up to 100,000 per platelet) and its function is well characterized. Integrin αIIbβ3 binds several ligands each containing an arginine-glycine-aspartic acid (RGD) sequence, such as fibrinogen, fibrin, vWF, fibronectin, thrombospondin and vitronectin [3]. After activation mediated by other platelet receptors, integrins shift to a high affinity state and efficiently bind their ligands [4]. This process requires the transmission of signals from the small cytoplasmic tails to the large extracellular domains of the integrin subunits [5]. Several proteins, including talin and kindlin-3, have been proposed to be involved in regulation of PLOS ONE | DOI:10.1371/journal.pone.0133429 July 14, 2015 1 / 11 Hic-5 in Murine Platelets integrin activation [6–12]. A functional role for these proteins in integrin activation in vivo could not be confirmed in all cases as, for example, in the case of RIAM [13]. Recently, KimKaneyama and colleagues reported that hydrogen peroxide-induced clone-5 (Hic-5) acts as a novel regulatory factor for integrin αIIbβ3 activation and platelet aggregation in mice [14]. Hic-5 was identified as a gene inducible by transforming growth factor β1 (TGFβ1) as well as hydrogen peroxide in a differential screen of cDNA libraries from the mouse osteoblastic cell line MC3T3-E1. The authors of that study speculated that Hic-5 has a role in the growth-inhibitory pathway associated with in vitro senescence and that down-regulation of Hic-5 contributes to tumorigenesis [15]. Hic-5 contains four LIM domains at the C-terminus and shares high homology with paxillin that has been shown to localize to focal adhesions and to interact with talin in platelets [16,17]. In addition, it has been recently shown that paxillin negatively regulates platelet signaling pathways resulting in augmented αIIbβ3 activation upon stimulation of glycoprotein VI (GPVI) or G protein-coupled receptors (GPCR) [18]. We generated Hic-5-null (Tgfb1i1-/-) mice and found, in stark contrast to the study by KimKaneyama et al. [14], unaltered platelet integrin function in vitro and in vivo. Material and Methods Animals Animal studies were approved by the district government of Lower Franconia (Bezirksregierung Unterfranken; AZ 54/11). Tgfb1i1+/- mice were generated by injection of embryonic stem cell clone EPD0817_1_D04 (KOMP) into blastocysts of pseudo-pregnant C57BL/6 females to generate germ line chimeras. Male chimeras were bred to C57BL/6 females to generate Tgfb1i1+/– mice, which were intercrossed to produce Tgfb1i1–/– mice and littermate wild-type controls. Mice were genotyped by PCR, with 5’ GGGACGGGGCGTAGATAAAG 3’ and 5’ GTGCAGCCCAGATTGTCTCT 3’ for the wild-type, and 5’ TAGATAGAGATGGCGCAACG 3’ and 5’ ACACCCATTCACACACTGGA 3’ for the Hic-5-null allele. Chemicals and antibodies Midazolam (Roche Pharma AG), fentanyl (Janssen-Cilag GmbH) and the antagonists atipamezol (Pfizer), flumazenil and naloxone (both from Delta Select GmbH) were used according to the regulation of the local authorities. ADP, human fibrinogen, indomethacin and polyclonal anti-GAPDH antibody (Antibody ID: AB_796208) were from Sigma-Aldrich (Schnelldorf, Germany). Fibrillar type I collagen (Horm) was from Nycomed (Munich, Germany). Integrilin was from GlaxoSmithKline (Munich, Germany). U46619 was from Enzo Life Sciences GmbH (Lörrach, Germany), thrombin was from Roche (Mannheim, Germany), apyrase type III was from GE Healthcare (Chalfont St. Giles, UK), low-molecular-weight heparin was from ratiopharm GmbH (Ulm, Germany). Monoclonal anti-Hic5 antibody (Antibody ID: AB_398703) and monoclonal anti-CD29 antibody (Antibody ID: AB_393729) were from BD Biosciences (Heidelberg, Germany). Polyclonal anti-paxillin antibody (Antibody ID: AB_315576) was from Biolegend (Fell, Germany), polyclonal anti-leupaxin antibody (clone: RB37022) was from Biorbyt (Cambridge, United Kingdom). (...truncated)