Identification of Multiple CYP19 Genes Encoding Different Cytochrome P450 Aromatase Isozymes in Brain and Ovary

0013-7227/98/$03.00/0 Endocrinology Copyright © 1998 by The Endocrine Society Vol. 139, No. 4 Printed in U.S.A. Identification of Multiple CYP19 Genes Encoding Different Cytochrome P450 Aromatase Isozymes in Brain and Ovary* ANNA TCHOUDAKOVA† AND GLORIA V. CALLARD Department of Biology, Boston University, Boston, Massachusetts 02215 ABSTRACT Evidence to date indicates that the gene encoding cytochrome P450 aromatase (P450arom) in humans is a single member of the CYPl9 family, but multiple CYPl9 loci and isoforms have been identified in pigs. Here we report the cloning and characterization of a second member of the CYP19 family in goldfish. A search for P450arom variants was prompted by studies showing that a full-length P450arom complementary DNA (cDNA) isolated from a goldfish brain cDNA library hybridizes with a high abundance 3 kb transcript in brain RNA but fails to detect a message in ovarian RNA. A stepwise PCR cloning strategy led to isolation of a 1.9-kb cDNA, which encodes a protein of 518 amino acids and has a predicted mol wt of 58.7K. The ovary-derived P450arom (-A) shares 68 –72% sequence identity with ovarian aromatases of other fish species, but only 62% identity with the homologous brain-derived P450arom (-B). Amino acid differences are distributed throughout the two goldfish P450arom forms, but presumptive functional domains are highly conserved. Both I N BOTH males and females, estrogen programs and coordinates developmental, physiological, and behavioral responses essential for reproduction. Conversion of C19 androgens to C18 estrogens is the rate-limiting step in estrogen biosynthesis and is catalyzed by an aromatase enzyme complex comprising a nicotinamide adenine dinucleotide phosphate (NADPH)-dependent cytochrome P450 reductase and a cytochrome P450 aromatase (P450arom), a product of the CYPl9 gene (for review, see Ref. 1). Although early studies focused on estrogen biosynthesis in placenta and ovaries, which are P450arom-rich and a major source of circulating estrogen, it is now understood that smaller amounts of estrogen are formed in close proximity to estrogen receptors in brain, fat, bone, gonads and other tissues, where it functions as a paracrine or autocrine factor (1). Based primarily on molecular cloning and characterization of P450arom complementary DNAs (cDNAs) from human tissues, the gene encoding aromatase is thought to be a single member of the CYP19 family, with regulatory complexity accomplished by tissue-specific usage of multiple promoters and untranslated first exons (1, 2). Received October 7, 1997. Address all correspondence and requests for reprints to: Gloria V. Callard, Department of Biology, Boston University, 5 Cummington Street, Boston, Massachusetts 02215. E-mail: . * This work was supported by grants from the National Science Foundation (IBN89 –16809 and IBN96 – 01297). The nucleotide sequence reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number AF020704. † Recipient of an Endocrine Society Summer Fellowship. P450aromA and -B are able to aromatize [3H]androgen to [3H]estrogen when expressed in nonsteroidogenic COS cells. Southern analysis and PCR-restriction analysis of genomic DNA using discriminating probes and primers indicates that a single locus encodes the brainderived P450aromB (CYPl9B), whereas one or two different loci encode the ovarian form (CYPl9A). Northern blot analysis revealed two P450aromA messenger RNAs (1.9 .. 3.0 kb) in ovary. Simultaneous PCR amplification with A- and B-specific primer pairs confirms that P450aromA is the only form expressed in ovaries, but shows overlapping expression of the two genes in neural tissues. Whereas P450aromB messenger RNA predominates in brain (B/A, '14:1), the ratios are reversed in retina (B/A, '1:25). Further studies are required to resolve the evolutionary and functional implications of multiple CYPl9 genes and P450arom isozymes in goldfish, their differential expression in brain and ovary, and whether observations can be generalized to other vertebrates. (Endocrinology 139: 2179 –2189, 1998) The ability of the gonads and brain to aromatize androgen is an evolutionarily conserved characteristic of vertebrates (3, 4). However, teleost fish, including the goldfish Carassius auratus, are unique among vertebrates in having exceptionally high levels of brain aromatase activity: e.g. 100- to 1000fold higher than mammalian brain but similar to mammalian ovary (5, 6). Enzyme activity is correspondingly high in teleost pituitary and retina, but ovarian aromatase is less than one-tenth that of brain (6, 7). To address the molecular mechanism of high constitutive neural aromatase expression, a full-length 3-kb P450arom cDNA was isolated from a goldfish brain library and used to show that high accumulated levels of P450arom messenger RNA (mRNA) in brain correspond to high enzyme levels (8). Paradoxically, the brainderived cDNA failed to hybridize with ovarian mRNA under any condition. This observation led us to postulate the existence of different brain and ovarian mRNA variants. Although evidence from chickens (9) and medaka fish (10) supports studies in humans indicating that the CYPl9 gene exists as a single copy in the haploid genome (11, 12), multiple CYPl9 loci encoding different P450arom isoforms in placenta, ovary, and blastocysts were identified in pigs (13–15). Here we report the isolation of a second P450arom cDNA from goldfish ovaries, and present evidence for multiple CYPl9 gene loci encoding the brain- and ovarian-derived P450arom forms. We show that both proteins are able to catalyze estrogen production from radiolabeled androgen, and are differentially expressed in neural and gonadal tis- 2179 2180 MULTIPLE CYPl9 GENES AND P450arom ISOZYMES Endo • 1998 Vol 139 • No 4 sues. Preliminary findings have been reported elsewhere (16). Materials and Methods Oligonucleotides Oligonucleotides (Ransom Hill Bioscience, Ramona, CA) used as PCR primers and probes for Southern analysis are listed below and shown in Fig. 1. Primers 1–11 were used with the ovarian P450arom cDNA, whereas 12–16 are complementary to brain P45Oarom cDNA: Primer 1: nucleotides 1173–1197: 59 AGG TWC CAK CCN GTB GTS GAC TTC 39 (IUB group codes were used: D 5 A1G1T; S 5 G1C; N 5 A1G1C1T; Y 5 C1T; R 5 A1G; K 5 G1T; B 5 G1T1C; V 5 G1A1C; W 5 A1T). Primer 2: nucleotides 1395–1416: 59 CACCATNGCDATRWRYTTNCC 39. Primer 3: nucleotides 1316 –1337: 59 TGGAAGTTGTCTAGACTGAAC 39. Primer 4: nucleotides 1303–1324: 59 GACTGAACTCATTCGGCTTGG 39. Primer 5: nucleotides 338 –359: 59 RGTBTGGATCWVYGGAGARGA 39. Primer 6: nucleotides 398 – 423: 59 TGAGGTGTACAGAGATTTCCTCAAC 39. Primer 7: nucleotides 1301–1329: 59 CCCCAAGCCGAATGAGTTCAGTCTAGAC 39. Primer 8: nucleotides 17– 43: 59 TCTTATGGCACGTGAACTTCTCCAGC 39. Primer 9: nucleotides 1848 –1874: 59 CAGTAGAAGACACCAGTAATTCATAG 39. Primer 10: nucleotides 1220 –1241: 59 TGATGTCATCGAAGGCTACAA 39. Primer 11: nucleotides 1274 –129 (...truncated)