Analysis of chicken anemia virus genome: evidence of intersubtype recombination

Virology Journal, Nov 2011

Chicken anemia virus (CAV) is the causative agent of chicken infectious anemia. CAV putative intergenotypic recombinants have been reported previously. This fact is based on the previous classification of CAV sequences into three genotypes. However, it is unknown whether intersubtype recombination occurs between the recently reported four CAV genotypes and five subtypes of genome sequences. Phylogenetic analysis, together with a variety of computational recombination detection algorithms, was used to investigate CAV approximately full genomes. Statistically significant evidence of intersubtype recombination was detected in the parent-like and two putative CAV recombinant sequences. This event was shown to occur between CAV subgroup A1 and A2 sequences in the phylogenetic trees. We revealed that intersubtype recombination in CAV genome sequences played a role in generating genetic diversity within the natural population of CAV.

Article PDF cannot be displayed. You can download it here:

https://virologyj.biomedcentral.com/track/pdf/10.1186/1743-422X-8-512

Analysis of chicken anemia virus genome: evidence of intersubtype recombination

Eltahir et al. Virology Journal 2011, 8:512 http://www.virologyj.com/content/8/1/512 RESEARCH Open Access Analysis of chicken anemia virus genome: evidence of intersubtype recombination Yassir M Eltahir1,3, Kun Qian1, Wenjie Jin1 and Aijian Qin1,2* Abstract Background: Chicken anemia virus (CAV) is the causative agent of chicken infectious anemia. CAV putative intergenotypic recombinants have been reported previously. This fact is based on the previous classification of CAV sequences into three genotypes. However, it is unknown whether intersubtype recombination occurs between the recently reported four CAV genotypes and five subtypes of genome sequences. Results: Phylogenetic analysis, together with a variety of computational recombination detection algorithms, was used to investigate CAV approximately full genomes. Statistically significant evidence of intersubtype recombination was detected in the parent-like and two putative CAV recombinant sequences. This event was shown to occur between CAV subgroup A1 and A2 sequences in the phylogenetic trees. Conclusions: We revealed that intersubtype recombination in CAV genome sequences played a role in generating genetic diversity within the natural population of CAV. Background Chicken anemia virus (CAV) was first reported in 1979 in specific-pathogen-free (SPF) chickens [1]. CAV belongs to the Circoviridae and is a non-enveloped, icosahedral virus with a negative-sense, single-stranded circular DNA. The viral genome consists of 2.3 kb, with three partially overlapping open reading frames. CAV infection is an economically important clinical and subclinical disease in broiler chickens, with a worldwide distribution [2]. CAV isolates show extremely limited genetic variability worldwide [3]. All isolates of CAV are suspected to belong to a single serotype [4]. Little is known about CAV genome recombination analysis. CAV putative intergenotype recombinants have been reported to occurs in the virus gene VP1 and results in a new virus genotype [5]. Recently, after adding more CAV approximately full genome sequences to GenBank, CAV sequences arising from different parts of world have been categorized into four genotype groups (A-D) and five subtypes (A1, A2, A3, D1 and D2) [6]. Therefore, the necessity of exploring these CAV genotypes for evidence of recombination as an important tool for genetic variability has been raised, * Correspondence: 1 Ministry of Education Key Lab for Avian Preventive Medicine, Yangzhou University, Yangzhou, 225009, PR China Full list of author information is available at the end of the article to establish if any would help in understanding the evolutionary process in the CAV genome. Here, we report evidence of intersubtype recombination based on sequence analysis of the entire coding regions (VP1, VP2 and VP3) of CAV genomes. Methods Samples DNA extraction, PCR screening, amplification of CAV genome, cloning and sequencing were carried out as previously described, briefly, primers VP1F: 5’AGCCGACCCCGAACCGCAAGAA’3 and VP1R: 5’ TCA GGG CTG CGT CCC CCA GTA CA’3 were used to amplify the VP1 region and primers VP2F: 5’ GCG CAC ATA CCG GTC GGC AGT’3 and VP2R: 5’ GGG GTT CGG CAG CCT CAC ACT AT’3 were used to amplify the VP2 region [6] for 10 spleen samples collected between April 2010 and December 2010 at Yangzhou University Veterinary Hospital during necropsy. Samples originated from different commercial chicken farms in Anhui (n = 3) and Jiangsu (n = 7) provinces. For each samples, DNA extraction and PCR was run at least twice. Animal experiments were conducted in accordance with the guidelines provided by the Chinese Council on Animal Care. All experiments complied with institutional animal care guidelines © 2011 Eltahir et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Eltahir et al. Virology Journal 2011, 8:512 http://www.virologyj.com/content/8/1/512 Page 2 of 7 JS-China 72 JS-China 85 China|HQ872030 China|HQ872029 JS-China 96 China|HQ872034 China|HQ872031 China|HQ872032 AN-China 95 USA|L14767 India|AY583758 CAV-P India|AY583756 CAV-B Bangladesh|AF395114 Malaysia|AY150576 BL-5P90 Malaysia|AF527037 Netherland|D10068 China|AF475908 Harbin Malaysia|AF390038 UK|U66304 Germ any|M81223|Cuxhaven 1 India|AY583755 CAV-A Germ any|M55918|CAECUX1 China|HQ872023 USA|AF311892 USA|AF313470 Del Ros Malyasia |AY040632 Japan|AB031296 J Malyasia|AF390102 China|AY843527 TJBD33 China|HQ872044 China|HQ872046 China|HQ872045 JS-China 81 AN-China 13 JS-China 80 JS-China 3 China|HQ872041 China|HQ872025 China|AY846844TJBD40 China|HQ872039 China|HQ872040 Japan|AB046590 China|HQ872033 China|HQ872035 China|HQ872038 China|HQ872036 China|HQ872047 Japan|D31965 China|HQ872028 China|HQ872042 China|HQ872043 China|HQ872026 China|HQ872027 USA|AF311900 JS-China 90 AN-China 92 China|HQ872024 China|HQ872037 Japnan|AB027470 TR20 India|AY583757 CAV-E Austrlaia|U65414 Japan|AB119448 Malaysia|AF285882 SMSC-1 Australia|AF227982 Australia|EF683159 A1 A2 A3 B D1 D2 C Figure 1 Phylogenetic analysis of the nucleic acid sequence of the 10 new complete VP1, VP2 and VP3 sequences from Anhui (AN) and Jiangsu (JS) provinces, China, and the 55 relevant VP1, VP2 and VP3 sequences currently available in GenBank. Values ≥ 70 are indicated on the branches (as percentages). Sequences from the present study (colored closed symbols) are named as PP-China, where PP is the area of origin. Sequences from GenBank were given the country name followed by accession number. The four major groups were identified as A, B, C and D. Eltahir et al. Virology Journal 2011, 8:512 http://www.virologyj.com/content/8/1/512 and were approved by University of Yangzhou Animal Care Committee (protocol number 06R015). Sequence analysis To look for recombination in CAV sequences, we used 55 published full genomes sequences that are currently available in GenBank, together with 10 sequences characterized in the present study. Multiple alignments of either CAV full or subgenomic regions were performed and analyzed using ClustalW [7]. Unrooted phylogenetic trees were constructed using the neighbor-joining (NJ) method, and visualized and edited using MEGA 3.1 software [8]. The evolutionary distances were estimated using the Kimura two-parameter method. Bootstrap analyses were performed with 1,000 repeat samples of the data sets. To reduce redundancy, isolates with previous reports of intergenotypic recombination [5] were excluded from analysis. Identification of recombination Recombination breakpoint events in the multiple alignments were detected with the Recombination Detection Program 3 (RDP3), using the automated suite of algorithms implemented in the RDP3 with default settings. These included RDP, GENECONV (...truncated)


This is a preview of a remote PDF: https://virologyj.biomedcentral.com/track/pdf/10.1186/1743-422X-8-512
Article home page: https://virologyj.biomedcentral.com/articles/10.1186/1743-422X-8-512

Yassir M Eltahir, Kun Qian, Wenjie Jin, Aijian Qin. Analysis of chicken anemia virus genome: evidence of intersubtype recombination, Virology Journal, 2011, pp. 512, Volume 8, Issue 1, DOI: 10.1186/1743-422X-8-512